Tweets at around 30km

It searches the Tweets of Twitter around 30km.


Search Results

Αργυρώ 👠 argie810

Αδυναμια μου τα παιδια μου... λατρεια η Παρος κ η σοκολατα....
Ολα μπορεις να τα αγνοησεις εκτος απ το συναισθημα.!!!!

RT @stellarusseau: Καλημέρα φίλες και φίλοι!
Καινούργια μέρα, κάντε κάτι καλό για τον εαυτό σας,κάτι που να σας φέρνει χαμόγελο στα χείλη,…

2018-04-27 17:37

Γιώργος Φαδάκης d1Gb4IFUU9rpVcm

Εθνικές Μεταφορές
Fadakis Trans

RT @Xristina130266: ...τα λόγια μας δεν τα σκορπάμε αλόγιστα στον αέρα...
τα εννοούμε...
όμορφη μέρα, πουλάκια💋

2018-04-27 17:37

KonDra drakonaki

Από παιδί.... στον ύπνο μου έβλεπα φωτιές!

RT @arisb1978: Μια μέρα θα τα θυμόμαστε όλα αυτά και θα ψάχνουμε να πιούμε για να ξεχάσουμε

2018-04-27 17:37

Μίνα Καρελη 🐾❤🐾 MinaKareli

RT @GiotaGiota6: 🌻🍃🌸το πρωί είναι αυτό που μου αρέσει περισσότερο🌸🍃🌻
~φαίνεται ότι όλα αρχίζουν απο την αρχή(!)

Όμορφη Παρασκευή εύχομαι μ…

2018-04-27 17:37

Nike Margaret Morgan NikeMorgan

Photograph wild flowers in and around Athens, Greece. Sing in choirs. Interested in botany, astronomy and geology. Sci-Fi fan. Half Greek, half Welsh! Taken!

Love #pilion #GREECE Lovely, semi-sweet #wine in the taverna. 😋 (See tweet above.) #Makrinitsa #HappyHour

2018-04-27 17:37

Christos Xanthakis ChristosXanthak

φαντάσου να κατεβάσει ο Μιχαλολιάκος υποψήφιο τον Γιατζόγλου,

για να λέει ύστερα "ορίστε έχουμε και μετανάστες στα ψηφοδέλτιά μας"...

2018-04-27 17:37

Marianthe Marianthe_T

2018-04-27 17:37

ε κ δ ο χ ή otra_version

λογομαχώ με τη σιωπή κι η σιωπή με νικάει

RT @BlackOlgitsa: Μια μέρα θα τα θυμόμαστε όλα αυτά..αφού τα ζήσουμε πρώτα..

2018-04-27 17:37

Μίνα Καρελη 🐾❤🐾 MinaKareli

RT @Xristina130266: ...τα λόγια μας δεν τα σκορπάμε αλόγιστα στον αέρα...
τα εννοούμε...
όμορφη μέρα, πουλάκια💋

2018-04-27 17:37

ayilenizin vera'sı † Hayirlivera

ama ben gülerim.dikkat komünist var.7ekim7 μόνο ο θεός μπορεί να με κρίνει BJK

@NazmSngn1 @poppicin Ne aaaaa?

2018-04-27 17:37

Sofh Faih FaihSofh

Είμαι απρόσιτη μόνο
για εκείνους
που δεν έχουν μάτια
να με διαβάσουν..!!

~thefiynet~ OXI ⛔ DM

RT @marialyta13: @FaihSofh Καλή σού μέρα Σόφη!!!😘💝

2018-04-27 17:37

Jim Mongoose JimMongoose

all my faults are normal. NODM από (Λαμία ή 1.70) κ κάτω. Δασκάλα μου η @LiqRom Εκδρομές:

RT @danaoula_ektor: Μόλις είπα σε παπά καλημέρα αντί για χριστός ανέστη. Τόσο αλητισσα

2018-04-27 17:37

kiriakos ioannou kdiwavvou

nov-08-2017 chanGed - aLl piCs firstLy likEd & tweetEd- bY addINg /photo/1 tO tHe liNk sTh magIc happeNs - jUst fOr fUn - welcomEd tO amarynthOs tO eAt togethEr

RT @mikromary: Οταν με ρωτουν "τι εχεις; " απαντω "εαρινη κοπωση" κ ξεμπερδευω

2018-04-27 17:37

Wrecked Angles The_Architext

1/2 French, 1/2 Greek, Architect, photographer... Loves good music from Classical to Hip-hop... 合気道

@LeGoulu @DomTower C’est vrai, c’est tellement “in” dernièrement d’être raciste, d’extrême-droite, et surtout réact…

2018-04-27 17:37

Γρύπας 77 gkoustourakis1

Οποίος με βλέπει χαίρεται οποίος με ξέρει κλαίει🔞 Ξεματιάζω τη➡ @sampoutsatsara The best

RT @MariaKanoni: Κάποιες φορές
η σιωπή..
είναι ο καλύτερος σύμμαχος. •°*

2018-04-27 17:37

johnny1248 JediFlippyDoer

Just an ordinary man doing ordinary things. Not so out of the ordinary.

@hitmanharj @AnfieldHQ If he wants to stay then he can stay.

2018-04-27 17:37

KesyFZ xsou81

Μπασκετικό Παναθηναϊκό ακαουντ με δώσεις ειρωνείας και τρέλας
Θα με βρείτε: #euroleague μέχρι να μας βγάλει ο προεδρος... Και #paobc

@lostgps Εξακολουθεί και με σοκάρει 😁😁

2018-04-27 17:37

sissi komi thetis2001

RT @dchalkiada: Φήμες για δυσαρέσκεια από τον Άγιο Παΐσιο μετά τον διορισμό προστατευόμενου του Άγιου Πορφύριου του Καυσορετιρέ. Αποσύρει κ…

2018-04-27 17:37

Ιουστίνος Τιμβερλέκιος MxdMartianFarts

καλύτερα να σου βγεί το όνομα παρά το μάτι

Άντε τώρα με τις πρώτες ζέστες να πας γι δουλειά στην κουζίνα...

Πείτε ότι θέλετε για την μιζέρια σας, αλλά μη μο…

2018-04-27 17:37

KikiM Kikiriklou

Να θυμάσαι οτι στο πάρτι της ζωής σου
εσύ δίνεις το ρυθμό!!!

ΟΛΥΜΠΙΑΚΟΣ λατρεία ❤

RT @Xristina130266: ...τα λόγια μας δεν τα σκορπάμε αλόγιστα στον αέρα...
τα εννοούμε...
όμορφη μέρα, πουλάκια💋

2018-04-27 17:37

Αη χασου..⚡ MariaZaxariou2

ασε μεσιε! πουλα την τρελα σου αλλου.. εγω εχω τη δικη μου...

RT @spanio_pouli: Μια μέρα θα τα θυμόμαστε όλα αυτά.. και θα τα διαψεύουμε κατηγορηματικά!!!

2018-04-27 17:37

◼◾On the Rocks◾◼ 30__kai

Ανακεφαλαιοποιημένος • •

Η φάση είναι ΠΡΟΛΑΒΕΤΕ ΤΟ ΔΙΕΥΘΥΝΤΗ

2018-04-27 17:37

Carpenter 🌶 PepeCarpenter

\___ @N_Liviti ___/---====

RT @faiouka: Καταργούν τα καλαμάκια? Ωραία, δε θα τσακώνομαι με την κόρη μου όταν τελειώνουν τα ροζ.

2018-04-27 17:37

Nullus Anxietas karmakosmische

the one with Cheryl Ladd on the cover

Κρατήστε μόνο το τελευταίο και ο κόσμος θα γίνει λίγο καλύτερος

2018-04-27 17:37

Georgia Panov geopanov

Ολα ειναι ταξιδι..

RT @MOTOSPORTINK: -Έχω μακροχρόνια σχέση
-Με ποιον
-Με έναν δεν το ξέρει

2018-04-27 17:37

َّسمَوِذّأّتّيِّ🇸🇦 Hadd2003

‏‏‏‏‏‏‏‏‏‏‏‏‏‏‏‏من نجد🇸🇦

RT @stellarusseau: " Τα όνειρα που μένουνε μονάχα μες στη σκέψη,
κάνεις μην τα πιστέψει...τα σβήνει η ζωή."…

2018-04-27 17:37

GlykeriaVeliou GlykeriaVeliou

RT @georgeERT1: Αν ήμουν γυναίκα και μου έλεγε ο γκομενος μου να το βγάλω αυτό που φοράω γιατί είναι κοντό, θα το έβγαζα και θα φόραγα πιο…

2018-04-27 17:37

َّسمَوِذّأّتّيِّ🇸🇦 Hadd2003

‏‏‏‏‏‏‏‏‏‏‏‏‏‏‏‏من نجد🇸🇦

RT @stellarusseau: @blakshadowgirl @altanitsa Βρε κορίτσια γιατί πάντα τα βλέπω μετά από 100+ χρόνια ?🤔
Όπως και να έχει, την αγάπη μου και…

2018-04-27 17:37

Spiros Gkontas spigko

"legal" Greek Fiba & Euroleague Referee

Δεν υπάρχει μεγαλύτερη ανηθικότητα από το να διαλέγεις 5 από τους 118, να τους "τιμωρείς" για να περάσεις το μήνυμα…

2018-04-27 17:37

Αργυρώ 👠 argie810

Αδυναμια μου τα παιδια μου... λατρεια η Παρος κ η σοκολατα....
Ολα μπορεις να τα αγνοησεις εκτος απ το συναισθημα.!!!!

RT @stellarusseau: ""Δεν μου ανοίκει τίποτα για το οποίο δεν πάλεψα.
Τίποτα δεν μου χαρίστηκε.
Τα κέρδισα όλα.
Ακόμα και τις καταστροφές μο…

2018-04-27 17:37

Gayle Vaughn Jedika365

RT @Jendrekan: Καλημέρα σε Όλους 🙋 με χαμόγελο και χαρά 🐓🐓🐓☕☕☕🐓🐓🐓🌻🌻🌻🌻🌻🌻🌻🌻

2018-04-27 17:37

na_parw_ta_bouna Wanda_Max1moff

Τα χάπια μας να μη ξεχνάμε κ όλα καλά!

RT @Maychara75: -Θέλω να μείνω μόνη
-Να σκεφτείς;
-Να πίνω τσίπουρο απ το μπουκάλι

2018-04-27 17:37

Sub rosa iamsubrosa

RT @Dark_Side_Gr: Its Like a Tai or Macao Parlor
@ValeNappi gives a Sensual Massage & Worships @PS_JBrownXXX Body & his most..Hidden Part h…

2018-04-27 17:37

DimitrisChalkiadakis dchalkiada

Diplomacy good εε ;; #58η_ημερα_αιχμαλωσίας

RT @RealPoliticsgr: Καθαρή έξοδος, καθαρή μπούρδα... -

2018-04-27 17:37

Stella 🌼 stellarusseau

RT @T_Bazotis: Μια πολύ όμορφη
Μέρα σε όλους και όλες
με ανθρώπους που μας νοιάζονται
που μας αγαπάνε όσο και εμείς........

💖💝🌹💝💖 https:…

2018-04-27 17:37

Gayle Vaughn Jedika365

RT @Jendrekan: @Zeta_Grg Χρόνια πολλά με υγεία αγάπη ευτυχία χαρά και χαμόγελο 🎂🎂🎂

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

AACATCTGTGCGTTATAAGAATTCACTCACCCGCTGCTCTTTAATGCGTGAGTCGGGCCGCGGTCGCAAACGGTTGTCAGGAGTTATCTGAGCTGCGAGTCCGAGGCTCAGCTTA…

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

CCAATTCACAATCATCGTTACCTTTCCGTAATGTGTCTCCCCGCGTATTTTATCGCGTTGGCGGCCCATTTTCCGCCGTTTTCGATCGACACGCACTTAGAACTACATGTGGCTA…

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

AAAAAGCCCTTCTTGGCCACAAAGCTCGAGACAGGCCTTATTCATAGACCCGGCAAAGCGCGAATAAGGGAGAAATAGGTGTTTTTGTAATCGGTCTGACAAAGGCTAAGACACG…

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

TCAGTAATATTTGTTAGCTACTCATAGTTATGGCGCTTTTGCCGTAAACCCGGCTTCCGCATCAACTCAGTGAGGTCATTTGATTTGCGGGCGATCTGGACAAGCGGAAATGCTT…

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

CTTCGCCGGCCTTTGCGGTAGACTATCTTGTAGAAGCAAGCGAGGGTCTTTTATTTAGTGGGAAGCGTTACGATGCGGAGTAGACTCCTCAGGTAGCGATGCCCTACGCCTTGAC…

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

ATGGAACATTTTTCCGCGAACAAGTGGACCTTTCACATATCTCGCGCCAAATGTGTTGCAGCTCCAACTACAAGCGCTAACGTGTCGCTTCAAGAACCTCCTTTGACAAAATTTG…

2018-04-27 17:37

The TOC TheTOC_gr

Ο επίσημος λογαριασμός του The TOC. Eιδήσεις κάθε λεπτό

Αμερικανοί γερουσιαστές μπλοκάρουν την πώληση F-35 σε Τουρκία

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

GGAATATATAATCAGAGGCTTACGCAAACTTCAAGTAATCACGGAACGCTATCCTAATCAAACATCAGAGTCGTGCTCTTTTACTCACAATTTGCCAAACAGTGTGAGCAGTATG…

2018-04-27 17:37

ayilenizin vera'sı † Hayirlivera

ama ben gülerim.dikkat komünist var.7ekim7 μόνο ο θεός μπορεί να με κρίνει BJK

@immortalcain Yok o misafir

2018-04-27 17:37

πουλακι τσιου poulakitsi

RT @panosarandis: Βρέθηκε ένας έκφυλος δικαστής που λέγεται Anthony Hayden και διέταξε την αποσύνδεση από το μηχάνημα του παιδιού., αλλά η…

2018-04-27 17:37

BinDNA bindna

DNA Sequence Generator

GGAGGCTATACAGGGCTTTAAGCTGGCGCAGTGGCTTTAGTGGGGCGATCCCGTTGCACCTCGTCTTACCACCGCTTATGTTATGAAAAATTTTGAACTTGGATGGGGGCGTTTC…

2018-04-27 17:37

Αργυρώ 👠 argie810

Αδυναμια μου τα παιδια μου... λατρεια η Παρος κ η σοκολατα....
Ολα μπορεις να τα αγνοησεις εκτος απ το συναισθημα.!!!!

RT @stellarusseau: Ξύνω λίγο την κρούστα της ευτυχίας...

2018-04-27 17:37

Το Ποτάμι - Πειραιάς/Σαρωνικός ToPotamiPiraeus

Official account. Είμαστε εδώ να αποδείξουμε,
ένα νέο τρόπο επαφής της πολιτικής με την κοινωνία.
Είμαστε εδώ να ξανακάνουμε πολιτική για τους πολίτες.

Εκδήλωση στην ΕΣΗΕΑ με θέμα «ποια στρατηγική για την Τουρκία»
#topotami

2018-04-27 17:37

Γρύπας 77 gkoustourakis1

Οποίος με βλέπει χαίρεται οποίος με ξέρει κλαίει🔞 Ξεματιάζω τη➡ @sampoutsatsara The best

RT @MariaKanoni: " Κλείνω τα μάτια
και σ' αναζητώ..."

2018-04-27 17:37

Pantelis Chiotellis🇬🇷 pantelischio

Pantelis Chiotellis #DigitalMarketing #strategy #branding | HubSpot Inbound Marketing & Email Marketing Certified | Interested in #MarTech & #Chatbots

19 Expert Tips on How to Build a Successful Business Blog

2018-04-27 17:37

liberal.gr LiberalGr

liberal - Ελεύθερη Ενημέρωση

Εμπρηστική επίθεση σε καφενείο στη Νίκαια #LiberalGr

2018-04-27 17:37

Люстрация fragileweb

Молодая графиня Безухова не была ни мила, ни любезна

RT @new_igeshka: Если вы вдруг пришли, увидев ретвит Василия, сообщаю: я пишу тексты. Тематика: культура, маркетинг и seo. Но вообще люблю…

2018-04-27 17:36

Γρύπας 77 gkoustourakis1

Οποίος με βλέπει χαίρεται οποίος με ξέρει κλαίει🔞 Ξεματιάζω τη➡ @sampoutsatsara The best

RT @MariaKanoni: Όσο και να μεγαλώσουμε ,το πατρικό σπίτι θα είναι πάντα το καταφύγιο μας*•°

2018-04-27 17:36

Medousa DarkWaterCircus

The Creature from the Black Lagoon

RT @dromografos: Διαβάστε όλα το thread για το ιστορικό της δίκης #PetrouRalli8 #PRalli8trial

2018-04-27 17:36

15 minutes 15minutes_gr

Όλες οι ειδήσεις και τα τελευταία γεγονότα από το 15minutes.gr!

Ανεξαρτητοποιείται βουλευτής της Ένωσης Κεντρώων και προσχωρεί στη ΝΔ -

2018-04-27 17:36

Sub rosa iamsubrosa

RT @Dark_Side_Gr: .@BRichXXX to @LexyBandera ...''Eat the Shit''!
ManAss Eating &..Shithole Cleaning!
Only in
http…

2018-04-27 17:36

andreas armaos AndreasArmaos

Sport journalist @ Eleftheros Typos

Διόρθωσαν το λάθος τους στον Πανιώνιο απέλυσαν πριν προσλάβουν τον Γιατζόγλου...

2018-04-27 17:36

HuffPost Greece HuffPostGreece

Η επίσημη Ελληνική έκδοση της HuffPost. Blogs, Πολιτική, Κοινωνία, Διεθνές, Τεχνολογία, Viral.

Ανεξαρτητοποιείται ο βουλευτής της Ένωσης Κεντρώων, Γιώργος Κατσαντώνης

2018-04-27 17:36

Katerina_diamond Katydiamond7

Everybody lies, Everybody leaves👽👽👽

RT @vre_Katerina: Χειρίζομαι καλά και τη γλώσσα. Ομιλώ εννοώ.

2018-04-27 17:36

pistepseto pistepseto

😋

Η ανόρθωση γλουτών είναι η πιο θανατηφόρα αισθητική επέμβαση

2018-04-27 17:36

Mamma mia! MarinaTs72

RT @NinaL198: Το τουιτερ ποτέ δεν πεθαίνει δεν μας σκιάζει φοβέρα καμιά.

2018-04-27 17:36

Xristos Xristos69739378

RT @ceoworld: Kate Hudson has told @harpersbazaarus that #Greece is her favourite place in the world

Greece is my…

2018-04-27 17:36

miss butterfly ms_butterfly12

Serwer: Pristina needs to normalize relations with Serbia μέσω του χρήστη @IBalkanNA

2018-04-27 17:36

Γρύπας 77 gkoustourakis1

Οποίος με βλέπει χαίρεται οποίος με ξέρει κλαίει🔞 Ξεματιάζω τη➡ @sampoutsatsara The best

RT @MariaKanoni: Να 'χαμε τώρα
ό,τι χρειαζόμαστε,
για να νιώσουμε όμορφα •°

2018-04-27 17:36

Αργυρώ 👠 argie810

Αδυναμια μου τα παιδια μου... λατρεια η Παρος κ η σοκολατα....
Ολα μπορεις να τα αγνοησεις εκτος απ το συναισθημα.!!!!

RT @stellarusseau: Πριν γράψεις κάτι, αγαπά και λίγο.
Καλησπέρα καλό σας απόγευμα!❤🌼❤🌼

2018-04-27 17:36

liberal.gr LiberalGr

liberal - Ελεύθερη Ενημέρωση

Ανεξαρτητοποιήθηκε από την Ένωση Κεντρώων ο βουλευτής Γ. Κατσιαντώνης #LiberalGr

2018-04-27 17:36

George GeorgeNicu4

love Arte..picture... photo... music.... love ocean.. traveling

RT @yianniseinstein: @albertopetro2 @migliaccio31 @BrindusaB1 @NadiaZanelli1 @rosellima46 @mmayr5 @Rebeka80721106 @MaurilioVitto @marialves…

2018-04-27 17:36

Vasilis Dikaiopoulos BDikaios

Sports fan, wrestling fan, TV fan, Movies Fan

@lostgps Μόνο ο Παπανικολάου όταν μάρκαρε κάποιο γκαρντ. Κανείς άλλος.

2018-04-27 17:36

Helen Kelly HelenKe96519888

Filmmaker, artist, animal lover. Producer of one cherished little person.

RT @argie810: ..οι μοσχοβολιές και η δροσιά του ανοιξιάτικου πρωινού κάνουν τον κόσμο ακόμη πιο όμορφο....!!!

Καλημέρα σε όλους 💕…

2018-04-27 17:36

Mamma mia! MarinaTs72

RT @NinaL198: σιδερώνω ενα πουκάμισο διάλειμμα αλλο ενα το ίδιο, γιαυτο δεν θα τελειώσω ποτε.

2018-04-27 17:36

Αργυρώ 👠 argie810

Αδυναμια μου τα παιδια μου... λατρεια η Παρος κ η σοκολατα....
Ολα μπορεις να τα αγνοησεις εκτος απ το συναισθημα.!!!!

RT @stellarusseau: " Τα όνειρα που μένουνε μονάχα μες στη σκέψη,
κάνεις μην τα πιστέψει...τα σβήνει η ζωή."…

2018-04-27 17:36

URANIA GAZELLI uraniagazelli

Handmade Plexiglass Bags | Clutches & Totes | Made in Greece

2018-04-27 17:36

Γρύπας 77 gkoustourakis1

Οποίος με βλέπει χαίρεται οποίος με ξέρει κλαίει🔞 Ξεματιάζω τη➡ @sampoutsatsara The best

RT @MariaKanoni: Θέλω να γυρίσω στην εποχή που όταν με ρωτούσαν "τι κάνεις" απαντούσα: "τον κόσμο ομορφότερο" °•*

2018-04-27 17:36

hlias hlias1979

“Η εμπιστοσύνη ανάμεσα σε ένα ζευγάρι είναι ό,τι πιο όμορφο βρίσκω σε μια σχέση μαζί με τα παθιασμένα φιλιά κ τις σφιχτές αγκαλιές...Σε σχέση με @melinaexcat

RT @stellarusseau: Καλημέρα και καλη συνέχεια να έχετε !🌼❤🌼🙋

2018-04-27 17:36

Nikitas P pnikitas1

RT @mkatsiki68: Να ξέρεις να κυβερνάς τη διάθεσή σου, γιατί αν δεν υπακούει τότε διατάζει.!!!…

2018-04-27 17:36

Люстрация fragileweb

Молодая графиня Безухова не была ни мила, ни любезна

RT @new_igeshka: У меня кстати со 2го мая отваливается подработка. Так что если у кого есть варианты или объявления увидите у друзей - пиши…

2018-04-27 17:36

☭ΚΚΕ (ν-δ) efarpax3

Οικολόγος Πράσινος
Φαν Τσιρώνη
Άθεος που σέβεται τους συμπολίτες

RT @aftodioikisi: Υπάρχει τρόπος...

2018-04-27 17:36

xgeorgio xgeorgio

IS/IT engineer (MSc,PhD) Working as R&D independent consultant in Machine Learning, Signal Processing, Medical Imaging, Security, Software Engineering, SQA/SPM.

'Peace and prosperity': Korean leaders plan declaration after rare summit

2018-04-27 17:36

Xristina Agr. Xristina130266

...τα λόγια μας δεν τα σκορπάμε αλόγιστα στον αέρα...
τα εννοούμε...
όμορφη μέρα, πουλάκια💋

2018-04-27 17:36

johnny1248 JediFlippyDoer

Just an ordinary man doing ordinary things. Not so out of the ordinary.

@AnfieldHQ I told y'all that nothing is too late for him to change his mind.

2018-04-27 17:36

MariaLyta13 marialyta13

@FaihSofh Καλή σού μέρα Σόφη!!!😘💝

2018-04-27 17:36

Themistoclis Chronop TChronop

Φοιτητής

RT @zoosos: Έκκληση για τη φροντίδα σκύλου που βρέθηκε λουσμένος με πετρέλαιο στο Πέραμα Αττικής

2018-04-27 17:36

Παρατηρητής Αθμονέων VpParatiritirio

Στις 6:00 μ.μ. η Εσπερίδα:«Ελλάδα, Ο γεωπολιτικός κρίκος της Ανατολικής Μεσογείου»

2018-04-27 17:36

Dimitri Doukoglou DukeOGlue

artist, comedian, engineer. Like DaVinci, only not.

Pronouns: he/his

Ten Years Later, Cory Doctorow's Little Brother Remains Inevitable via @tordotcom

2018-04-27 17:36

AXIS THOMOS achisthomos3

ΜΑΡΤΙΟΣ 2015

RT @GiotaGiota6: 🌻🍃🌸το πρωί είναι αυτό που μου αρέσει περισσότερο🌸🍃🌻
~φαίνεται ότι όλα αρχίζουν απο την αρχή(!)

Όμορφη Παρασκευή εύχομαι μ…

2018-04-27 17:36

kiriakos ioannou kdiwavvou

nov-08-2017 chanGed - aLl piCs firstLy likEd & tweetEd- bY addINg /photo/1 tO tHe liNk sTh magIc happeNs - jUst fOr fUn - welcomEd tO amarynthOs tO eAt togethEr

RT @mikromary: Μια μερα θα τα θυμομαστε όλα αυτα και θα γελαμε...Τωρα δεν μας φαινονται αστεια

2018-04-27 17:36

Makis jpapouts

Kôres - Boutique Hotel & Spa: Κερδίστε ένα ονειρεμένο Σαββατοκύριακο στα Ζαγοροχώρια

2018-04-27 17:36

peristeraRa peristeraRa

#stopYulinforever #boycott_lamogia #σύριζα_ήθελες_έ_σκάσε_και_πλήρωνε #tsimpa_1 #StopBoknal #stopthebarbarians #AdoptDontshop

RT @RealPoliticsgr: Καθαρή έξοδος, καθαρή μπούρδα... -

2018-04-27 17:36

We drink him TheSokrates

Αγαπητε Επισκεπτη,
ΠΑΛΙ ΕΔΩ?μη σε κραταμε ΦΥΓΕ..ωσπου να φυγεις ομως εχουμε και ανανεωμενη λιστα 👉 👈

RT @arisb1978: Μια μέρα θα τα θυμόμαστε όλα αυτά και θα ψάχνουμε να πιούμε για να ξεχάσουμε

2018-04-27 17:36

Kathimerini English Edition ekathimerini

Kathimerini English Edition is a daily newspaper published in Athens. It is distributed exclusively with the NYT International Edition in Greece and Cyprus

Moscovici: Post-program surveillance examined for Greece to ensure reforms remain on track

2018-04-27 17:36

Αργυρώ 👠 argie810

Αδυναμια μου τα παιδια μου... λατρεια η Παρος κ η σοκολατα....
Ολα μπορεις να τα αγνοησεις εκτος απ το συναισθημα.!!!!

RT @stellarusseau: " Η γυναίκα ξέρει τι ζητάει και με κάποιο περίεργο
τρόπο ,πάντα το βρίσκει.".
Να έχετε μια όμορφη, ηλιόλουστη, χαρού…

2018-04-27 17:36

John Raptis XSOZ

Electronic music composer

Win a copy of Nothing Personal and the Scenes of the Crime Location Pack from @StarlingGames and @ETBoardGames! Con…

2018-04-27 17:36

AXIS THOMOS achisthomos3

ΜΑΡΤΙΟΣ 2015

RT @chriskaralis4: Καλημέρα Ειρήνη σ ευχαριστώ πολύ .....☺☀🌷☕🙏💋🙋@sefpapanikolaou

2018-04-27 17:36

Vasilis RToum toumvas

ΑΕΚάρα μια ζωή, χαβαλέ, μπασκετάκι, ψαροτούφεκο, κάνω RTια, αδερφος ο @ekizucchero από ελληνικά μόνο @karalaik (με πληρώνει)

RT @MOTOSPORTINK: -Ελα παρασκευαρα !!!
-Προτιμώ το Βούλα...

2018-04-27 17:36

ΜΒ vaswm2

RT @indianos11: -Εχω χάσει την πίστη μου στον άνθρωπο.
-Κοίτα πίσω απ τον καναπέ.

2018-04-27 17:36

BetoNews betonews_com

Το BetoNews είναι το απόλυτο εργαλείο για το στοίχημα. Ειδήσεις, προγνωστικά, βαθμολογίες, stats, livescores και η πληρέστερη βάση δεδομένων στην Ελλάδα.

Πλήρη αγωνιστική δράση στην Β Γαλλίας, που βγάζει εξαιρετικά σημεία. Δείτε αναλυτικά:

2018-04-27 17:36

Guru Plato Guru_Plato

Kau ada karena kau berpikir

Katanya pembunuhan ulama itu hoax ? Yg bener gimana sih?

2018-04-27 17:36

elapoueisai xa_xa_xa_xo_xo

μαντζαρη εισαι μαξ για 10 λεπτα για να ξεκουραζεις την παιχταρα τον στρελνιεξ

@drazen_11 @Melayess Θελω 3-0 με 20ρες μέσα έξω και αυτο θα γίνει

2018-04-27 17:36

AXIS THOMOS achisthomos3

ΜΑΡΤΙΟΣ 2015

RT @mikromary: - Κάπου σε έχασα
- Η μετάφραση θα φταίει

2018-04-27 17:36