Tweets at around 30km

It searches the Tweets of Twitter around 30km.


Search Results

Nina ninalexx

RT @Marina_Thy: Όσοι έχετε μεγάλη ιδέα για τον εαυτό σας, πάρτε και μια δεύτερη γνώμη....

2018-07-19 03:30

Christina Dim ChristinaDim3

Αρσακειο Τοσιτσειο Εκάλης

RT @papadimoulis: Πρώτες στη διαφθορά η αστυνομία και η δικαιοσύνη στην Ελλάδα - ThePressProject

2018-07-19 03:30

Τό κύτταρο bluesk1esandme

Διαιρειται πολλαπλασιαζομενο απο βιτσιο της φυσης.!

RT @paminos3: καλησπερα απο αθηνα!!!

2018-07-19 03:30

KarathanasisAthanasi k_athanasi

Software engineer

RT @YiannisLoverdos: Ενα απο τα μεγαλύτερα παραμύθια της 4ετίας Συριζανελ ήταν το διαβόητο «ηθικό πλεονέκτημα» της Αριστεράς, που ουδέποτε…

2018-07-19 03:30

adonios prokopidis TonisProkopidis

πρώην ιπτάμενος στην Ολυμπιακή.

@n1234nina Καλό σου βράδυ Κωνσταντίνα.

2018-07-19 03:30

Φιλελέ βδέλυγμα GiVeltsi

Antisocial engineer. Libertarian. Entertainer-entrepreneur. Ninjassassin vigilante. Opinion baker. Bilderberg's
puppeteer. I use humor as an offense mechanism

RT @grpsarianos: Από τον ΣΚΑΠΑΝΕΑ του αδερφάτου Παύλου-Ηρακλή με τις εργολαβίες της Χούντας,
στην ΔΙΟΔΟ της Λαοκρατίας του ξαδερφάτου Ζανέτ…

2018-07-19 03:30

Nikos Mekias artofsmilegr

SHOFU Pilot Lab Hellas 🇬🇷
SHOFU International Advisor 🌍
Osaka Ceramic Training Center, Osaka_Japan 🇯🇵
Art of smile_ Aesthetic dental laboratory

Cyprus, Limassol 🇨🇾 01 / September / 18
SHOFU Vintage PRO Lecture & practical demonstration
#SHOFU_Seminar…

2018-07-19 03:30

wantNOwork AposPapakos

Μάλλον επειδή είμαι τεμπέλης #δενειμαισιγουρος

RT @beatBukowski: η μανα μου νομιζει οτι δεν παντρευομαι επειδη διαβαζω βιβλία

2018-07-19 03:30

ΝiKi🌛 Phoebe1_

Just for fun. ✨🔮 (I miss the Old Twitter)

@BuffyHDBluRay You asked for permission to do the same for Buffy? They provide you with the episodes?

2018-07-19 03:30

Siwarde J. Sap SapSiwarde

Sr Advisor Economic Policy Affairs, NL embassy | Steering Comm. | #economicdiplomacy | RTs not (necessarily) endorsements.

RT @naftemporiki_en: The following day in Europe, and #Greece

2018-07-19 03:30

Athens Voice AthensVoice

Η μεγαλύτερη εβδομαδιαία εφημερίδα

«Κατηγορώ» του Γιώργου Καμίνη προς τα υπουργεία Υγείας και Προστασίας του Πολίτη. Του @er_td4

2018-07-19 03:30

FaShion FReaks FaShion_FReaks

Το πιο φρέσκο fashion portal!Είσαστε FaShion FReak?
Το 1o fashion portal που ασχολείται με Street Fashion,Casual,Sport Clothing τα πάντα!

Η φούστα που μπορείς να εμπιστευτείς για να δημιουργήσεις τα δικά σου άνετα, θηλυκά και πάνω από όλα vintage chic σ…

2018-07-19 03:30

EurohoopsGR eurohoopsGR

Basketball Website

Ολυμπιακός: Ο δεύτερος Λετονός Γιάνις έπιασε... λιμάνι! (pics+vids) | Eurohoops

2018-07-19 03:30

Illegal Potami IPotami

το Illegal αρχικά είχε την έννοια ότι δεν εκφράζω την επίσημη άποψη στο Ποτάμι, τώρα που έφυγα λόγω της συμμετοχής στο Κίνημα Αλλαγής, έχει ουσία
#illegalpotami

RT @grpsarianos: Κατι πηρε τ' αυτι μου για "απαντησεις" -σε τι πραγμα?..- απο δυο στελεχη απο ΤΟ ΠΟΤΑΜΙ, εναν κυριο και μια κυρια.
Ελπιζω ν…

2018-07-19 03:30

folita_folie folita_folie

Ο χειροτερος κριτης του εαυτου μου
ειμαι εγω..οι αλλοι δεν με αγγιζουν..

RT @vlaxakolonakiou: Καμία μεγάλη αγάπη δεν μένει κρυμμένη.
Αν ντρέπεσαι γι αυτήν δεν είναι αγάπη!

2018-07-19 03:30

To Arma me tous agious bmwdakiasss

Ιδιότροπος😀 Συνεταιρος στην νυστα @miamia28m μην μας ξυπνατε.Στη ζωη μου έλεγα οτι αισθανόμουν εκανα οτι ενιωθα και τα @@@@@ μου τα πήρα ειχα πρόγραμμα παιδιά.

@miamia28m Μα να σου πω τώρα όπως είμαι και παραπάνω αρκεί να τα είχα όλα κλειστά...

2018-07-19 03:30

protothema.gr protothema

Greece’s No. 1 news site & best-selling Sunday newspaper. Follow for breaking news, special reports and more from
@protothema / #protothema

Die Welt: Ο Ερντογάν ίσως ζητήσει βοήθεια από το ΔΝΤ εάν συγκρουστεί με τις αγορές #protothema #protothema

2018-07-19 03:30

Evi evimrkou

Υπάρχει ζωή μετά το καλοκαίρι;

RT @TOPONTIKI: Λύθηκε το μυστήριο σε ποιον ανήκει η σαρκοφάγος 30 τόνων  που ανακαλύφθηκε στην Αλεξάνδρεια

2018-07-19 03:30

Aristeidis Aristeidis5

Take or leave it.That's the deal!

RT @PGPapanikolaou: Τέσσερεις μήνες απλήρωτες οι εφημερίες των γιατρών του Παίδων "Αγλαΐα Κυριακού". Εκεί στα γραφεία των υπουργών Υγείας τ…

2018-07-19 03:30

Bokalidis Bokalidis1

@elena_grv123 @g_rodis Καλησπέρα

2018-07-19 03:30

MissBloomgr MissBloomgr

Μόδα, ομορφιά, συμβουλές, star looks και πολλά ακόμα σε περιμένουν στο αγαπημένο γυναικείο site!

Το αστρονομικό ποσό που έλαβαν για μια μόνο βραδιά!

2018-07-19 03:30

mato X0FLkIL0DQjzx3V

RT @etyposgr: «Φούσκα» του #ΣΥΡΙΖΑ η #offshore του @AdonisGeorgiadi που απαντά με εξώδικα | #ΕΤ

2018-07-19 03:30

Athens Magazine AthensMagazine

Το Athens Magazine, το επίσημο lifestyle περιοδικό της πόλης, κυκλοφορεί στα καλύτερα!

Μεγάλωσε πολύ!

2018-07-19 03:30

Esquire Greece esquiregreece

Ο άντρας στα καλύτερά του

Στη Φλωρεντία παίζουν άλλη μπάλα.

2018-07-19 03:30

travelstyle.gr travelstyle_gr

Το απόλυτο ταξιδιωτικό portal της Ελλάδας! Προορισμοί, ταξιδιωτικά ρεπορτάζ, videos, φωτογραφίες, σούπερ προσφορές και μηχανή online booking, ΟΛΑ ΣΕ ΕΝΑ!

8 Ρομαντικά νησιά που δεν γνωρίζεις ακόμα!

2018-07-19 03:30

Alexandros Chousakos alexchousakos

History Major and Philosophy Minor at DEREE - The American College of Greece - RT's are not endorsements

RT @capitalgr: Κ. Μητσοτάκης προς Α. Τσίπρα: Προκήρυξε εκλογές πριν τη ΔΕΘ

2018-07-19 03:30

Εκκρεμότητες ekkremothtes

μια φωτιά ένα αποτύπωμα μια σιωπή

@60LZLqpX2gn9jia @ThanosGeo82 χαχαχαα
νασαι καλά

2018-07-19 03:30

folita_folie folita_folie

Ο χειροτερος κριτης του εαυτου μου
ειμαι εγω..οι αλλοι δεν με αγγιζουν..

RT @doctorakos7: Λέει μια φίλη μου "Το κάμπινγκ αποτελεί παράδοση στην οικογένεια μας".
Μαράκι μου το κάμπινγκ αποτελούσε παράδοση σε κάθε…

2018-07-19 03:29

Alexandra aLe3ouLiNii

| Msc. in CS | Caffeine addiction. | Cat person. | Chocolate lover. |

RT @tsalavoutou: Τι μου λείπει και δε μπορώ να έχω ένα σπίτι στο Σουνιο?

2018-07-19 03:29

isminouta isminouta

ο,τι φαμε ο,τι πιουμε κι οτι αρπαξει ο κωλ(π)ος σας

13 ωρες μετά τη γυμναστικη δεν έχει έρθει η ευεξία. Μόνο κάτι μελανιές

2018-07-19 03:29

διαστημικος magerrpanos

2018-07-19 03:29

ΑΠΕ-ΜΠΕ amna_news

Αθηναϊκό - Μακεδονικό Πρακτορείο Ειδήσεων: το εθνικό ειδησεογραφικό πρακτορείο της Ελλάδας |English: @amna_newseng |Sport: @praktoreiosport

🔴 Σε αποκλεισμό το American University στην Ουάσιγκτον λόγω ενδεχόμενης ένοπλης επίθεσης

2018-07-19 03:29

Ανθή anthianthia

Διδάσκω την πιο όμορφη γλώσσα του κόσμου 📚
(ταπεινό ακκάουντ)

RT @doctorakos7: Λέει μια φίλη μου "Το κάμπινγκ αποτελεί παράδοση στην οικογένεια μας".
Μαράκι μου το κάμπινγκ αποτελούσε παράδοση σε κάθε…

2018-07-19 03:29

Pat Wart Patwart

Psychanalyse, théâtre, cinéma, littérature, philosophie, musique, photo,.... la vie quoi !!

RT @sissyest:

2018-07-19 03:29

Marina Miliou m_miliou

"Love has no age, no limit and no death "

RT @alcissa: Kalimera Ελλαda.. 😎💙📸🇬🇷

2018-07-19 03:29

BinDNA bindna

DNA Sequence Generator

TACGATGGACCCGTACCAAGGTCTGCGTCCTACTTCAGAGGTTTGTTCCACTAGTGATTATGAAAAATGTAAAGGGGATCGCCGGGCAGAAACACCGTAGTGGGTACAAAGGACA…

2018-07-19 03:29

Zacharias Parimeros Zach_Parimeros

Head Men's Basketball Coach at National Hellenic Naval Academy (ΣΜΥΝ) / Founder of BBT

A.A.= Awesome Anfernee..

2018-07-19 03:29

Spanio Pouli🧚🏻‍♂️ spanio_pouli

Gin lover και ροκού!Τρελλή&αδιάφορη για τα θεματάκια σου..έχω δικά μου!Έλασεπαρακαλώ!!

RT @arisb1978: καλύτερη αεροπορική εταιρεία στον κόσμο η Singapore, που για να ταξιδέψω μαζί της βρίσκω οικονομική θέση στην αγκαλιά του πι…

2018-07-19 03:29

Siannis sar_iannis

RT @xstefanou: Για αυτόν τον Μαντέλα δεν γιορτάζει κανείς σήμερα

2018-07-19 03:29

helenplagera helenplagera

RT @YiannisLoverdos: Καλά αυτοί οι συριζαίοι δεν παίζονται. Ξέραμε ότι ήταν ψευταράδες. Αλλά τώρα, κάθε μέρα που περνά, και θα βγαίνουν τα…

2018-07-19 03:29

BinDNA bindna

DNA Sequence Generator

CCAGCGTTGTCTAGTATTATGAGACCTAACATCTCGATCCGATACCGCATTACCTTTATGATTGTTTGACTACAGTGTTAGATCCTGCCGGCGGCTGGGGGTAACTCGCAACCAC…

2018-07-19 03:29

BinDNA bindna

DNA Sequence Generator

GGCGCACACTCGATAGTGGTGACGTAAGTTATCCCTACTCATAACCTCATATGCGTCAATATGATAGTCGGACTCGTTGTAAAGTAGTGGCACATGGTAGGTAGCGCTCTAAGAA…

2018-07-19 03:29

Domi chatzidomna

RT @beatBukowski: μανα ειναι αυτο που στη λέει στη λέει στη λέει και στο τελος στο κλεινει γιατι στεναχωρήθηκε

2018-07-19 03:29

Diana☀️ dianadep1

Passion for art, painting, sculpture, photography, design & tennis. Love animals, travel & nature. Advocates human rights & freedom of speech. NoDM #ArteYArt

RT @yianniseinstein: @alleosa @dianadep1 @monica74761144 @marmelyr @Amyperuana @agustin_gut @1Atsuhimerose2 @scastaldi9 @angelicadisogno @n…

2018-07-19 03:29

ALEXANDER Alexgreat1967

RT @YiannisLoverdos: Ενα απο τα μεγαλύτερα παραμύθια της 4ετίας Συριζανελ ήταν το διαβόητο «ηθικό πλεονέκτημα» της Αριστεράς, που ουδέποτε…

2018-07-19 03:29

Φαιναρέτη Ρωμανού FainaretiRom

Πρόεδρος Δ.Ω.Σ.Ε.
Υποψήφια ευρωβουλευτής & Υπεύθυνη Επικοινωνίας. Αναισθησιολόγος, μητέρα ενός γιου

RT @PetrosKatsakos: 2500 χρόνια είχε να πέσει άνθρωπος από τριήρη...

2018-07-19 03:29

χανούμ mpourek

Τράβα μαλλί ανεβαίνουμε

RT @toumvas: Μου τελείωσε το υγρό για το ηλεκτρονικό τσιγάρο κ έχω αρχίσει να βλέπω το αζαξ με άλλο μάτι.

2018-07-19 03:29

Όμορφα Ταξίδια omorfatax

2018-07-19 03:29

dinos palaio DinosPalaio

@BakourosV @Makedni Δεν συμφωνω με ολα τα post ολων των χρηστων,αλλα με το δικαιωμα τους να λενε την αποψη τους .Καλο βραδυ

2018-07-19 03:29

Fernanda kccatchme

If a man talks shit, then I owe him nothing

ESSE MASHUP É VIDA

2018-07-19 03:29

Nikos Hidiroglou NikosHidiroglou

Δημοσιογράφος (μέλος ΕΣΗΕΑ), AEKάρα, γενικώς ανήσυχος

Σκοπιανό: Νέο μεγάλο συλλαλητήριο στη Θεσσαλονίκη ανήμερα της συνέντευξης του Τσίπρα στη ΔΕΘ

2018-07-19 03:29

Ion Papadakis ion_papadakis

Δε θα ζήσεις μία ελεύθερη ζωή...έχοντας ένα φυλακισμένο μυαλό ... Journalist, Radio Producer

Αλήθεια, τι θα έκανες αν «τελείωνε» ο χρόνος;

2018-07-19 03:29

Georgios Moschovis GeorgeMoschovis

Economist - tweeting my personal views only.. retweeting others’ views I agree with..🕷

RT @hellenicpolice: Γνωρίζουμε από προσωπική εμπειρία, ότι το κινητό αποσπά την προσοχή του οδηγού, έστω & για ελάχιστα δευτερόλεπτα, χρόνο…

2018-07-19 03:29

katrrin kattrriin

εγινα χωριάτισσα.. και την πατησα..

RT @paspar_tou: Ο εγωισμός μετράει πάντα αυτά που έδωσες.
Ποτέ αυτά που πήρες

2018-07-19 03:29

adonios prokopidis TonisProkopidis

πρώην ιπτάμενος στην Ολυμπιακή.

@HelenPapamakar1 Ελένη και για σένα επίσης.

2018-07-19 03:29

Eliza Salpisti pontoonaki

SETE Hub Region of Central Macedonia - Greek Tourism Confederation &
Floating infrastructure professional (blue growth, floating docks, floating solutions)

RT @setegreece: Κάθε 1€ που καταναλώνεται στον τουρισμό, δημιουργεί υπερδιπλάσιο εισόδημα για την χώρα. #kiomos #ax…

2018-07-19 03:29

Nko 🇬🇧🇬🇷 notacrook1

🌞 🍁 😂 bun your hype

@GadSaad The price of tea in China?

2018-07-19 03:29

maria MariaVergin04

αποφοιτη λυκειου,γεννηθηκα στο πανεμορφο νησι της Λέσβου.Ζω στην Αθηνα εδω και πολλα χρονια.
Ειμαι αισιοδοξη και μου αρεσει να διαβαζω,να ακουω μουσική κ.α

2018-07-19 03:29

décadence misartekahlo

RT @mpaountolino: Ρε αδερφέ μαζί σου, να την βγάλεις την Ελλάδα από το σκοτάδι στο φως, καμιά ιδέα ποιος την έβαλε στο σκοτάδι και της έκρυ…

2018-07-19 03:29

gazzetta.gr gazzetta_gr

Η καλύτερη δημοσιογραφική ομάδα του αθλητικού internet παίζει μπάλα εδώ!

Μεγάλο πλήγμα για τον σχεδιασμό του Γίργκεν Κλοπ!

2018-07-19 03:29

tanukisan varasamsaramara

πίνω για νά αλλα δεν

RT @platitudinous: Δύο ήταν οι σημαντικότερες ειδήσεις σήμερα.

1. Πρώτες σε διαφθορά στην Ελλάδα η Αστυνομία και η Δικαιοσύνη.

2. Η Δικα…

2018-07-19 03:29

Adis ploutwnasADIS

RT @thenighttsun: Τι καφέ πίνετε;
Ψηφίστε και κάντε και κανένα RT ρεμάλια..... άντε.... 🙃

2018-07-19 03:29

Zahir Marvell Zahir_Marvell

αυτά που δεν θέλω να ξεχάσω τα γράφω στο χέρι μου, για όλα τ' άλλα υπάρχουν κι άλλα μέρη ;)☕

RT @mikromary: - Ασε με, τα 'χω με τον εαυτο μου
- Κ εγω που νομιζα οτι τα ειχες με τον Γιώργο
- ...

2018-07-19 03:29

capital.gr capitalgr

Κεφάλαιο στην οικονομική ενημέρωση

Οργή ΥΠΕΞ: Κατηγορεί τη Μόσχα για ασέβεια

2018-07-19 03:29

David P Perlmutter - #BookToMovie davepperlmutter

#WrongPlaceWrongTime is becoming a #Movie with @goldenmileprods & #Screenwriters are Carol Ann & Aileen Docherty #USA PR @CarthensKelly #editor @JulesTucker

RT @FrostieMoss: @davepperlmutter @goldenmileprods @DonnaSiggers1 @candystreats @wilkravitz @PensivePoet97 @JimIsRelentless @mark_and_sam S…

2018-07-19 03:29

Πασπαρ-Τού🍀 paspar_tou

Ψιτ...Για να μπεις εδώ ντύσου κόσμια μέσα έξω.Αλλιώς μην μπεις στον κόπο. @antzy1982 τουιτεροκοράκλα💖 Θαλασσάκι μου η @agnister11💙

@panosepi Σου χω πιο βαρυσήμαντο.
Μια γυναίκα δε βγαίνει ποτέ για ψώνια μαζι με τον αντρα της το απαγορεύουν κανόν…

2018-07-19 03:29

Yiannis Einstein yianniseinstein

Μόνο το χιούμορ σε εμποδίζει να πάρεις στα σοβαρά τις θεωρίες σου τον εαυτόν σου και τους άλλους

@alleosa @dianadep1 @monica74761144 @marmelyr @Amyperuana @agustin_gut @1Atsuhimerose2 @scastaldi9 @angelicadisogno…

2018-07-19 03:29

The Daily Heller thedailyheller

Print magazine's favorite blog, The Daily Heller, is Steven Heller's well-trained look at...well, everything!

RT @parachutetype: From pencil #sketch to digital #letterform. This elegant lowercase gamma (γάμμα) which is part of the Regal #type family…

2018-07-19 03:29

alekoglou katerina alekogloukateri

είμαι από τη Θεσσαλλλονίκη και με αρέσει

RT @PetrosKatsakos: 2500 χρόνια είχε να πέσει άνθρωπος από τριήρη...

2018-07-19 03:29

Tantz Aerine TantzAerine

Greek author & activist. I make Without Moonlight webcomic. Patreon: @drunkduck's twitter admin.

#WebcomicWednesday 's pick from @DrunkDuck !

2018-07-19 03:29

isminouta isminouta

ο,τι φαμε ο,τι πιουμε κι οτι αρπαξει ο κωλ(π)ος σας

Ο άλλος μας έχει πρήξει αυτά που δεν έχουμε ότι δεν μπορεί τη ζεστη, λες κι εμείς είμαστε τίποτα αναστενάρηδες και γουστάρουμε

2018-07-19 03:29

Christina Dim ChristinaDim3

Αρσακειο Τοσιτσειο Εκάλης

RT @EiriniLampraki: Δεν θα σχολιάσω... δεν χρειάζεται 😂😂😂😂😂

#ΚΕΕΛΠΝΟ

2018-07-19 03:29

Hannia hannniasaenz

for your eyes only

RT @bjennymontero:

2018-07-19 03:28

I_did_it_my_way dititmyway

RT @gioxar1: Μπαίνω σ ένα μαγειρείο, τι καλό έχουμε του λέω? Άργησες φιλαράκι μου λέει, μια μερίδα γιουβετσάκι, τρία γεμιστά λίγα σουτζουκά…

2018-07-19 03:28

ΜΛΜ panos_san16

δεν εχω,δεν θελω,δεν θα βαλω σερτς και δεν σας αρταρω με σερτς.ΑΥΤΑ

RT @doctorakos7: Λέει μια φίλη μου "Το κάμπινγκ αποτελεί παράδοση στην οικογένεια μας".
Μαράκι μου το κάμπινγκ αποτελούσε παράδοση σε κάθε…

2018-07-19 03:28

Alexandros Chousakos alexchousakos

History Major and Philosophy Minor at DEREE - The American College of Greece - RT's are not endorsements

RT @KalenteridisSav: Τον Τούρκο πρόεξνο που πληρώνει με μαύρα ματωμένα λεφτά τον ψευδομουφτή Κομοτηνής πρέπει να απελάσει η κυβέρνηση, αν θ…

2018-07-19 03:28

ά-Χρηστος Φαταούλ-ας chrisfas61

Τα βιβλία μου έχουν πρωτογενείς πλεονασμούς /

RT @LazarosKokkalis: Η νέα μόδα απαιτεί να ονομάζεις το κάθε έγκλημα, πολιτική δίωξη.
Φόνους κάνεις? Πολιτική δίωξη!
Κατακλέβεις το δημόσιο…

2018-07-19 03:28

e-nea365 e_nea365

RT @bankingnewsgr: Συναγερμός στην Ουάσιγκτον – Ένοπλος στην πανεπιστημιούπολη του American University

2018-07-19 03:28

beatBukowski beatBukowski

The world is full of crashin' bores. Don't try.

@figios χρησιμοποιείς σφουγγάρι; Νομιζα εισαι αντρικο ακαουντ

2018-07-19 03:28

Μάνατζερ Ράγκμπι panosst16

RT @JamesASB: Πάτε και ερωτεύεστε τον άνδρα που σας κράτουσε τα μαλλιά στην πίπα κι όχι εκείνον που θα σας τα κράταγε μπροστά σε ένα πιάτο…

2018-07-19 03:28

Lampros Gkaragkanis LGkaragkanis

Journalist / Blogger

@onlygreen13 έτσι. να πονάει :)

2018-07-19 03:28

Complete unknown a_k_a_Jim

RT @stavroulaber: Ready, Freddie?
Bohemian Rhapsody | Official Trailer [HD] | 20th Century FOX via @YouTube

2018-07-19 03:28

ElisabethLn ElisabetLwna

RT @ntokkel: Ο απέναντι έχει 4 αμάξια, 1 μαγαζί και 1 τριώροφο από πάνω και δεν έχει μια κόρη ρε μαλάκα.

2018-07-19 03:28

Prapaskaya Prapaskaya

Απο που κι ως που,πως και ποσα...

RT @vlaxakolonakiou: Καμία μεγάλη αγάπη δεν μένει κρυμμένη.
Αν ντρέπεσαι γι αυτήν δεν είναι αγάπη!

2018-07-19 03:28

Ηθικός Πλεονέκτης Afragos7

Στα παπαρια μου ο Τσιπρας ουτε που τον ψηφισα αλλα τέτοιο μίσος, εμπάθεια και οργανωμένη λάσπη δεν εχει φάει καμία άλλη κυβέρνηση ποτε

RT @AthanDim: Μαζί της ετοιμάζονται να "πετάξουν" και τα επιτόκια...

2018-07-19 03:28

Mary ma_rrie_d

black is a happy color

RT @Argyro_pap: Τσακώνονται οι γείτονες από δίπλα του φωνάζει αυτή "Παραδέξου ότι είσαι μαλάκας!". Βάζω μουσική να μην τους ακούω, χτυπάει…

2018-07-19 03:28

Smith Truth SmithTruth

Νιώθω μέσα μου ένα κενό.
Λάθος, απ' έξω είναι.

Ότι θα πήγαινα σε πανηγύρι στην #ikaria κ θα χρειαζόμουν γυαλιά ηλίου δεν το φανταζόμουνα (αν όχι κ αντηλιακό)

2018-07-19 03:28

Christina Dim ChristinaDim3

Αρσακειο Τοσιτσειο Εκάλης

RT @SamiouAina: Εγώ πάντως λαχάνιασα!! #σκαΝΔαλα

2018-07-19 03:28