Tweets at around 30km

It searches the Tweets of Twitter around 30km.


Search Results

BinDNA bindna

DNA Sequence Generator

GCCAATGACTATTCCGCCCAATCCTGACTAAAGCACCCAGCTCACCAACTCAGAGAGGATGCCACCGCCCCGTCTTTTCCTGCGGTTTTCCTGAGGCTAAGGGAGTAAATTTAGA…

2018-09-19 01:01

pascal δε ρασκαλ rascalbafmdmmm

#mystylerocksgr πάμε λίγο μαναφουκι να ανέβουν τα νούμερα Τάμτα... άναψε φυτιλιες queen Dina

2018-09-19 01:01

BinDNA bindna

DNA Sequence Generator

GCGGGCAAGGTATTGCAGGTACTAGTATAGTGGTACGAACTTGACAAACCTCTAAGGATATTTATGTTTTTGACTATCGATCATCCAATGTCTACGTAGGTCATTTATCACCGAC…

2018-09-19 01:01

BinDNA bindna

DNA Sequence Generator

GATCCGCATATGTCTCCCCAGATCAATGAGCCACCTTTGGCGATTCGTAACCGCTTAAGTGCAGAGCGTCTGTACTGTGTTTCGGCGTGACCATGCGCGGAGGCGTGTTAATGGA…

2018-09-19 01:01

BinDNA bindna

DNA Sequence Generator

CCCGCCCAACTTGAGTTAGCCTACGTCCATCTTAAATACGCCAGCACATCTGGCTCAGTTTACAGACACTCACGGCTAGTCCTGAACAACGAGTCTCACTAGACTTAGCGGATTA…

2018-09-19 01:01

Dhmou Mairi DhmouMairi

RT @sakisioann: Ο Πρόεδρος της ΝΔ @kmitsotakis, έκανε μια από τις καλύτερες και πιο τεκμηριωμένες ομιλίες στη #ΔΕΘ, από όσες άκουσα. Ωστόσο…

2018-09-19 01:01

BinDNA bindna

DNA Sequence Generator

TTTCTGCACTAGACTACCTTAAATTTAGAATATCAATTGGCCCTGGTTTTCCACCAATAAATTCTGGGTGCCAGGCGTTCACCGGATGACACGATATAACTCGAATAGAGTCCAA…

2018-09-19 01:01

BinDNA bindna

DNA Sequence Generator

TGTAGTTGGGTTTTCCAATCCGTTTATTCGGTGCCGACCCAGTGTGTAAGTAAGATCATCAGCAATAAGAAAAAAACTGACTTGACGACTAGTCAAACACTAAGTCAGAGATCGG…

2018-09-19 01:01

. Congemiality2

RT @davidpollack47: 12 years ago today my World was forever changed. Everything I grew up wanting to be was taken away in one hit. Never do…

2018-09-19 01:01

Ave Maria* MariaP3tridi

δεν είμαι αυτό που νομίζεις

RT @elinampounia: Η Πόπη μας αναζητά σπίτι.Γέννησε στο δρόμο,αναλάβαμε όλη τη σκυλοοικογένεια γιατί τους πετούσαν πέτρες.Σε μια σταλιά πλασ…

2018-09-19 01:01

ΟΜΑΔΑ ΣΟΙΜΠΛΕ xristikos76

RT @kyranakis: Τέλος η παρουσία στελεχών της Νέας Δημοκρατίας στην ΕΡΤ. Κρίμα, γιατί μου άρεσαν τα εκτός έδρας.

#ΕΡΤ #ΣΥΡΙΖΑ

2018-09-19 01:00

Vassiliki vasskal

RT @PGPapanikolaou: Στο δεξιοφιλελέ τουίτερ για τον ένα αστυνομικό με τις σωβρακοφανέλες που άφησε τους Ρουβίκωνες να σπάσουν ένα τζαμάκι,…

2018-09-19 01:00

Antenna News AntennaNews

Το ειδησεογραφικό site του Ομίλου ΑΝΤ1.

RT @x_papad: Δείτε απόψε στο Κεντρικό Δελτίο Ειδήσεων του @ANT1TV στις 19.30 με το @NChatzinikolaou : τι συμβαίνει στη Σκόπελο; Σε λίγη ώρ…

2018-09-19 01:00

γ🍴τί __gati__

Φαγανός κεραμιδόγατος💙:🌞,🌊,🍕

RT @Sakattack71: Τοσα χρόνια στη δουλειά μου το μεσημέρι πάντα τρώω ενα τοστ. Που την εκρυβα τοση σεξουαλικότητα; Και κυρίως γιατί δεν το ε…

2018-09-19 01:00

aggelos ♏ aggelosv1

Καλύτερα να μετανιώσεις για κάτι ΠΟΥ ΕΚΑΝΕΣ...παρά για κάτι ΠΟΥ ΔΕΝ ΕΚΑΝΕΣ! | ΠΑΤΡΙΣ ΘΡΗΣΚΕΙΑ ΟΙΚΟΓΕΝΕΙΑ

RT @toumvas: -Μανα δεν με παίζουν τα άλλα παιδάκια, λένε ότι βρίζω.
-Γιατί;
-Γιατί γαμιούνται.

2018-09-19 01:00

Anastassios anastassios2401

"Η ελευθερία του να γνωρίζεις, να εκφράζεις άποψη και να επιχειρηματολογείς ελεύθερα και με συνείδηση, είναι η σημαντικότερη από όλες τις ελευθερίες"Τζον Μίλτον

@agelaw_7 @aektzougiapanta Γκουρμέ τουί..

2018-09-19 01:00

ΣΤΑΥΡΟΣ ΦΥΝΤΙΚΑΚΗΣ fintikis

Πρόεδρος στο Ίδρυμα Νιάρχου η τέως υπουργός Λυδία Κονιόρδου

2018-09-19 01:00

caramelo zaissaa_

si tu me cherches je suis à bako djicoroni aci

RT @MCamarajr10: Pour toi papa 🙏🏾⚽️Repose en paix 🙌🏾

2018-09-19 01:00

γ🍴τί __gati__

Φαγανός κεραμιδόγατος💙:🌞,🌊,🍕

RT @Sakattack71: Επειδή μου αρέσει να χρησιμοποιώ συχνά τις παρακάτω λέξεις,τις γνωρίζετε και εσείς;Μη γκουγκλάρετε όμως έτσι;

ΞΕΜΠΛΕΤΣΩΤΟ…

2018-09-19 01:00

a Land Panther alandpanther

bioλογικός αντιβραστήρας Όλα; είναι βρώμος Γεμάτο κενό

RT @toumvas: -Φιλαράκι έμεινα από λάστιχο, έχεις σταυρό στο αμάξι;
-Ένα ματάκι έχω.

2018-09-19 01:00

sofikar sofikar

RT @NineLivesGreece: SOS!!! Εκκληση για βοηθεια για στειρωσεις και τροφες για αδεσποτες γατουλες, η κυρια που τις φροντιζει δεν μπορει να α…

2018-09-19 01:00

Tελεία και Παύλα vre_Katerina

Μια ρομαντική ρεαλίστρια. Κατά φαντασίαν αστεία. Περιστασιακά καριόλα. Διαφωνώ αλλά σε νιώθω. Γυπαετίνα. Old school. Κινούμενο μπάχαλο. Σαρκασμός. Παροξυσμός.

Ντα ντα ντα
ντα ντα ντα
θα σε κάνω ντα ντα

2018-09-19 01:00

Ταξικός Σανέμπορας Mary_Skou

Πουλάω σανό στα γίδια που το έχουν ανάγκη. Είμαι parody account για αυτούς που δεν τρώνε σανό. Για τους υπόλοιπους είμαι κανονικό!

RT @dchalkiada: ΠΟΙΟΣ «Τουρμπγέρν» βρε τουρμποζώα, τουρμποβλήματα, Τουρμποάχρηστοι.

«ΤΟΡΜΠΙΟΡΝ» προφέρεται βρε ζώα,ανοίχτε ένα youtube, β…

2018-09-19 01:00

Dimitrios Palimeris dimgerpal

@Beringloss @V_of_Europe I ‘ve seen payslips in the news with that sum. I know they have WiFi, souvlaki, free healt…

2018-09-19 01:00

George Iliopoulos george_ili

SARCASM! Because beating people is illegal

@QPlayground Δεν πάει το τσουλος... Ας βρούμε μια άλλη λέξη

2018-09-19 01:00

HuffPost Greece HuffPostGreece

Η επίσημη Ελληνική έκδοση της HuffPost. Blogs, Πολιτική, Κοινωνία, Διεθνές, Τεχνολογία, Viral.

2018-09-19 01:00

Euronews ελληνικά euronewsgr

To κανάλι με τη μεγαλύτερη τηλεθέαση στην Ευρώπη

Μήνυμα Τσίπρα για την επέτειο της δολοφονίας Φύσσα

2018-09-19 01:00

Human Ⓥ🔻🏳️‍🌈 ☮️ 🏞️ non-conform Ilona_GR_DE

Never forget 🇬🇷 28 Oct 1940 #ΟΧΙ Day! ✊5. July 2015 NO to the sell-out and economic war against #Greece! #HumanRights and #Equality are indivisible🌍 Stay human!

RT @MakisSinodinos: Ξεκίνησε η πορεία , στη κορυφή οι γονείς του #KillahP

2018-09-19 01:00

gazzetta.gr gazzetta_gr

Η καλύτερη δημοσιογραφική ομάδα του αθλητικού internet παίζει μπάλα εδώ!

Τι αρπαγή ήταν αυτή!!!

2018-09-19 01:00

Ο δύσπιστος Θωμάς parafed1

...

RT @MakisSinodinos: Ξεκίνησε η πορεία , στη κορυφή οι γονείς του #KillahP

2018-09-19 01:00

🏖️ Ζαν ντ'Αρτ 🏖️ lybejohn

BSc Accounting. Apple  fan. (Neo)Liberal/Center-Right. Animal rights activist. Dopes: Music, TV/cinema & gadgets. Christian Orthodox. Amateur singer.

Αρχίζει το σόου! 😎

2018-09-19 01:00

flix.gr flixgr

Everything you wanted to know about cinema (and you were afraid to ask)

Καλημέρα Αγγελοι. Ο Πάτρικ Στιούαρτ θα είναι ένας από τους Μπόσλεϊ στους νέους «Αγγελους του Τσάρλι»…

2018-09-19 01:00

Helen Angel😇 AngelAngelopou1

GREEK AMERICAN, DGR in Art❤love-PEOPLE,ANIMALS,MUSIC,flowers,Poets,Art,Romantics,Comedians.

RT @stellarusseau: Μια βιαστική " Καλημέρα" παιδιά , καλή δύναμη και αισιοδοξία ,αυταααα🙋 με αγάπη!🌼

2018-09-19 01:00

Αδεσποτος adespotos_

RT @altanitsa: ✔️✔️✔️

2018-09-19 01:00

Sakis Sakattack71

Να ξερεις οτι εμεις οι ιδιοι φταιμε που αυτος ο κοσμος παει κατα διαολου.Μην φερεσαι σαν αυτους που κατηγορεις

@GiorgosStefano2 Έχεις δίκιο αδερφέ.Αυτό που εκπέμπει μια γυναίκα δεν εχει να κάνει με τα κιλα της,το υψος της ή το…

2018-09-19 01:00

Ταξικός Σανέμπορας Mary_Skou

Πουλάω σανό στα γίδια που το έχουν ανάγκη. Είμαι parody account για αυτούς που δεν τρώνε σανό. Για τους υπόλοιπους είμαι κανονικό!

RT @aektzougiapanta: Η φάρμα των ζώων!!!!
Γιατί κυρίες και κύριοι...Ολα τα ζώα είναι ίσα, μερικά είναι πιο ισα από τα άλλα!!!! …

2018-09-19 01:00

zouzouni news zouzouninews

Ειδήσεις, νέα, σχόλια, απόψεις, από την Ελλάδα και όλο τον κόσμο ....και σε όποιον αρέσουμε !

the fun bank: ΚΛΟΟΥΝΣ (CLOWNS) photos - wallpapers (ανανεωμένο)

2018-09-19 01:00

Zaxariadou Martha myrtozax

''Αν δεν μπορείς να κάνεις τη ζωή σου όπως τη θες,τούτο προσπάθησε τουλάχιστον όσο μπορείς,μην την εξευτελίσεις... '' Κ. Καβάφης

RT @Vkikilias: Στις εκλογές θα αναμετρηθούν αυτοί που θέλουν την Ελλάδα ουραγό, χώρα φτωχοποιημένη για να μοιράζουν επιδόματα φτώχιας & συμ…

2018-09-19 01:00

👶🏽👶 🧒🧒K.P 🧚‍♂️🤷‍♂️ chappilot1

RT @aektzougiapanta: @chappilot1 @agelaw_7 Τα πάντα όλα, ασε χαχαχαχα χαχαχαχα χαχαχαχα

2018-09-19 01:00

Vlodril Vlodril

Video games, Let's play's and streams. Reviews / Previews. ,

Ben Reilly Lives! - Let's Play Marvel's Spider-Man Part 12 - PS4 Pro: via @YouTube

2018-09-19 01:00

k A k OY Koukourouku antitapantaola

doctor doctor please...

Η πρώτη προσπάθεια απέτυχε Κώστα,πάμε για την επόμενη

2018-09-19 01:00

Provocateur iProvocateur

Ζωή και Εμπειρίες. Μυαλό και Σκέψεις.

Το κοπλιμέντο το τρυφερό, το ζουζουνιάρικο, το ρομαντικούλι. 😍

2018-09-19 01:00

look mom..........no hands maryskyis

Μου ανάβει τα λαμπάκια ο @Charmingassh0le με την εμμονή του για γάμο αλλά είναι και γαμώ τα άτομα 😘 με προστατεύουν οι @AnnaAgios και η @lountzaki όπως και εγώ

RT @arisb1978: σας ποτίζει καθόλου το συναίσθημα του πόνου; ή ειστε τίποτα γομάρια;

2018-09-19 01:00

IACOVOS CHARALAMBOUS IACOVOSCH

RT @Radio_98fm: Η πορεία έχει περίπου 2000 άτομα. Στην κεφαλή το πανί φίλων και οικογένειας #killahp και απο πίσω αριστερές οργανώσεις και…

2018-09-19 01:00

PENELOPE MANETA PENELOPE_GR

TEACHER OF A PRIMARY SCHOOL.

RT @effielaskar: Η αποψη του Καψωχα αφορουσε στο προγραμμα του Μητσοτακη που ανακοινωσε στη ΔΕΘ. Μιξη νεοφιλελευθερισμου με ασφαλιστικο Πιν…

2018-09-19 01:00

Popy Kaia popykaia

Charter Director at Atalanta Golden Yachts

Sailing is what sets your heart free!
S/Y Gitana

2018-09-19 01:00

M Victoria Figueroa Lozano MVictoriaFigue1

RT @eleniard: #EnginAkyürek #Kerem
#ÇocuklarSanaEmanet #KeremHastaLaEternidad

2018-09-19 01:00

Πράσινο σπίτι 4greenGR

Το είναι η ιστοσελίδα του περιοδικού ΠΡΑΣΙΝΟ ΣΠΙΤΙ & ΚΤΙΡΙΟ, πού καλύπτει τα θέματα της αγοράς για εξοικονόμηση και "πράσινη ενέργεια"

Μάθετε τα πάντα για τα προϊόντα και τις υπηρεσίες της LEDVANCE.
#4green #led #ledfwtismos #Ledvance

2018-09-19 01:00

travelstyle.gr travelstyle_gr

Το απόλυτο ταξιδιωτικό portal της Ελλάδας! Προορισμοί, ταξιδιωτικά ρεπορτάζ, videos, φωτογραφίες, σούπερ προσφορές και μηχανή online booking, ΟΛΑ ΣΕ ΕΝΑ!

Θεωρείται ένα από τα θαύµατα της φύσης και αποτελεί Mνηµείο Παγκόσµιας Κληρονοµιάς της UNESCO.

2018-09-19 01:00

MissBloomgr MissBloomgr

Μόδα, ομορφιά, συμβουλές, star looks και πολλά ακόμα σε περιμένουν στο αγαπημένο γυναικείο site!

Η «Βασίλισσα Ελισάβετ» δεν μπόρεσε να μην συγκινηθεί!

2018-09-19 01:00

Vengefoυλ mugiop

Ο περιπτεράς

|This world is just illusion, always trying to change you|

Δεν είσαι stalker, απλά έχετε βγει μια ρομαντική βόλτα χωρίς αυτή να το ξέρει

2018-09-19 01:00

pestaola.gr pestaolagr

Ο επίσημος λογαριασμός του pestaola.gr: Τεχνολογία, web, apps, gaming, ψηφιακή φωτογραφία

Η Apple λανσάρει τα λειτουργικά συστήματα iOS 12, watchOS 5 και tvOS 12 | Pestaola

2018-09-19 01:00

JL Waaren ⭐⭐ TrystanWRN

Un seul numéro un , deuxième c'est dernier ...
#CR7 #SRFC #halamadrid GT : WaarenVIII PSN : WaarenVIII COD Player quand le jeu est bien mdr

RT @MCamarajr10: Pour toi papa 🙏🏾⚽️Repose en paix 🙌🏾

2018-09-19 01:00

Iason Yannis Schizas iasonschizas

15 Scientifically Proven Ways to Work Smarter, Not Just More

2018-09-19 01:00

Violeta shoegal_84

Fashionable Lifestyle Blogger || Freelance Translator || Social Media & Marketing Enthusiast

[NEW POST] THE BENEFITS OF YOGA BEFORE BED. Yoga can help relax your mind, calm your mood and take away the stresse…

2018-09-19 01:00

mariana tsnmari

Μεσ' το όπλο σου σφαίρα

@Bill_Advised Α μ άρεσε αυτό

2018-09-19 01:00

Zaxariadou Martha myrtozax

''Αν δεν μπορείς να κάνεις τη ζωή σου όπως τη θες,τούτο προσπάθησε τουλάχιστον όσο μπορείς,μην την εξευτελίσεις... '' Κ. Καβάφης

RT @aektzougiapanta: Στην χώρα πουτανα όλα κ κάποιοι επιμένουν να "διυλιζουν τον κωνωπα κ να καταπίνουν την καμηλο" !! Τ αφήνω έτσι για να…

2018-09-19 01:00

Alpha Bank Alpha_Bank

Ο επίσημος Twitter λογαριασμός της Alpha Bank, με τα τελευταία νέα και τις ανακοινώσεις μας. Διαβάστε τους όρους χρήσης εδώ:

Η Alpha Bank συνεισφέρει στην επίτευξη των στόχων βιώσιμης αναπτύξεως (SDGs), όπως αυτοί έχουν τεθεί από τα Ηνωμένα…

2018-09-19 01:00

Thomas Bichtas Erevos9

Press Officer - Olympiacos FC

Long time no selfie. stellasamouilidou #selfie #halfface #eyes #smiles #olympiacos #family @ Olympiacos FC Academy

2018-09-19 01:00

MacroPolis MacroPolis_gr

MacroPolis is a subscription-based service providing analysis and data on the political, economic and social situation in Greece. We put Greece in perspective.

No imminent decision on pension cuts as Athens moves ahead with minimum wage increase #Greece #economy

2018-09-19 01:00

Νικος mafioso ugEcH9dIkIfCqWo

40(και βαλε) χρονια εφηβος,ξεφτιλας δον κιχωτης!!!

@HGeorgil Μεγαλη κουβεντα ειπες φιλε...αληθεια!!!

2018-09-19 01:00

Ria_ 2018Ria

Looking for camera poems and inspiring people. ... / No DM

@jperezcafe Thank you!💐

2018-09-19 00:59

GStasi46 gstasi46

Father. Entrepreneur. Anti-fascist and anti-neoliberal. Nature lover.
Isaac Asimov wrote my Bible.

RT @ViliardosV: Νοιώθει κανείς απλά απέχθεια όταν ακούει στελέχη της κυβέρνησης να ισχυρίζονται ότι το κόμμα τους είναι προοδευτικό, αριστε…

2018-09-19 00:59

Helen Angel😇 AngelAngelopou1

GREEK AMERICAN, DGR in Art❤love-PEOPLE,ANIMALS,MUSIC,flowers,Poets,Art,Romantics,Comedians.

RT @LnysQuweYyendcE: Καλημέρααααααα!!!!!

2018-09-19 00:59

gogo® gogomoka1

/> my soulmate @seilormoun
my sister @mariamoka3

RT @30__kai: Όταν λέτε χέστηκα να το εννοείτε, όχι σαν εμένα που το λέω αλλά ταυτόχρονα τραβάω τα μαλλιά μου

2018-09-19 00:59

Tonyzones Tonyzonest

please follow 💯follow back

RT @paminos3: @BLACKKOMISSA 😊☺️😍

2018-09-19 00:59

Kostas Farkonas Mithrandir

Disillusioned journalist, tech nut, cynical gamer, music addict, book buff, movie maniac, wine lover. All views and comments expressed strictly personal.

RT @mpaountolino: Τιμή και δόξα στον Παύλο Φύσσα, απεριόριστος σεβασμός στην Μάγδα Φύσσα και ψόφο στους Ναζί.
#KillahP

2018-09-19 00:59

Tonyzones Tonyzonest

please follow 💯follow back

RT @paminos3: καλημερα!!!!!

2018-09-19 00:59

blackolgitsa BlackOlgitsa

Αδυναμίες @sinarelena @kardoula525 Προσοχή!!αλεγκρα προσωπικότητα!εισέρχεστε με δική σας ευθύνη..

RT @paspar_tou: Εσάς που δε μας αφήνετε χώρο να στενοχωρηθούμε σας αγαπάμε λίγο παραπάνω να ξέρετε.
* ταυτόχρονα σας μισούμε κιόλας αλλά ας…

2018-09-19 00:59

Effie Tsironi EffieTsironi

In Books I Trust - Diligent translator and negligent writer

RT @dchalkiada: Πήγαινε στις φυλακές και ρώτα τον Λούλα, μια που θάσαι εκεί.

2018-09-19 00:59

Ave Maria* MariaP3tridi

δεν είμαι αυτό που νομίζεις

RT @elinampounia: Τον υπέροχο Τζώτζη,που μόνο αγάπη έχει να δώσει,ξαφνικά αποφάσισαν ότι δεν τον θέλουν.Είναι φιλικός με ΟΛΟΥΣ,υγιέστατος,π…

2018-09-19 00:59

jimbo dimyboy

Ένα ξέρω, ότι δεν ξέρω τίποτα!

RT @ma_mounaki: ξενυχτησα στην πορτα σου και σιγοτραγουδωωωωωωωω εδω ειναι ο παραδεισος κι η κολαση εδωωωωωωωωωωωωωωωωωωωωωωωωωωωω

2018-09-19 00:59

elalege elalege

information must flow

RT @MakisSinodinos: Ξεκίνησε η πορεία , στη κορυφή οι γονείς του #KillahP

2018-09-19 00:59

mary furn maryfurn

RT @LiberalGr: Η ΕΣΗΕΑ καταγγέλλει τη χρήση προσβλητικών σχολίων, παραπέμπει τον Σ. Καψώχα #LiberalGr

2018-09-19 00:59

Δρομογράφος dromografos

Commentary account about the political situation in Greece - For English @dromografosNews. Communication info@dromografos.news Also

RT @Radio_98fm: Η πορεία έχει περίπου 2000 άτομα. Στην κεφαλή το πανί φίλων και οικογένειας #killahp και απο πίσω αριστερές οργανώσεις και…

2018-09-19 00:59

HuffPost Greece HuffPostGreece

Η επίσημη Ελληνική έκδοση της HuffPost. Blogs, Πολιτική, Κοινωνία, Διεθνές, Τεχνολογία, Viral.

@olgagerovasili

2018-09-19 00:59

||||||| tOuz-tOuz ||||||| tOuztOuz7

Δεν ξερω γιατι αυτος που εγραψε τα νουμερα και τους υπολογισμους στην αβαταρ φωτο μου δεν δουλευει στην ΝΑΣΑ

RT @arisb1978: σας ποτίζει καθόλου το συναίσθημα του πόνου; ή ειστε τίποτα γομάρια;

2018-09-19 00:59

konstantinos.mi kostasmichos

Ask me...

RT @kanaliotis: Απο χτες είμαι προβληματισμένος και ζητώ την βοήθειά σας.
Οι κηδείες που έγιναν από «μαϊμού» παπάδες είναι άκυρες;

2018-09-19 00:59

POLITICSNEW politicanea

Η νέα ενημέρωση τώρα και στο

RT @naftemporikigr: Πανελλαδική Επιτροπή Μπλόκων: Δε βολευόμαστε με ψίχουλα

2018-09-19 00:59

Fotofraktis fotofraktis

RT @xstefanou: O Μπέζος της Amazon βοηθά τους αστέγους… που ο ίδιος δημιουργεί

2018-09-19 00:59

Kontra Channel KontraChannel

Αττική: 52 & 49 UHF (DIGEA) / NOVA: 852 / OTE TV: 651 / LIVE STREAM:

Γιάγια Τουρέ: "Πάμε να κερδίσουμε το Europa League..."

2018-09-19 00:59

Βασίλης Βιλιάρδος ViliardosV

Οικονομολόγος, (ΑΣΟΕΕ Αθηνών, Msc Πανεπιστήμιο Αμβούργου Γερμανίας) - Αντιπρόεδρος της Ελληνικής Λύσης FB:

@Andreasmessm Ασφαλώς μπορούμε.

2018-09-19 00:59

Costas Milonas milonas

Πρέπει να σταματήσω να αναλύω τα πάντα. Με αρρωσταινω χωρίς λόγο.

@IwannhsXwston Θεϊκό!

2018-09-19 00:59

Antonis Papav antonispapav

Artist/Record Producer/Recording Studio owner/Radio program Producer

@Desmotis74 @ThanosTzimeros

2018-09-19 00:59

Astrology.gr astrologygr

**Η Αστρολογική σου Συνήθεια!**

Πες μου τι ζώδιο είσαι, να σου πω ποιο βότανο να πάρεις!

2018-09-19 00:59

Depi 🍀🍀🍀!!! DepiZym

👠👠👠Μην δικαιώσεις ποτέ με τη φλυαρία σου, αυτούς που τους βολεύει η σιωπή σου...!!!...

RT @gmkpapakostas: Ισοαποστάκηδες αυτή η μάστιγα της Ελλάδας...

2018-09-19 00:59

Ναυσικά nafsika71

Όπου κι αν γίνεται η αδικία, αποτελεί απειλή
για την απανταχού δικαιοσύνη...

RT @Elikas: Τα δύο άκρα είναι η ΧΑ με τους δολοφόνους της και η φασιστερά με τους Ρουβίκωνες που πετάνε τρικάκια (εναντίον της κυβέρνησης).…

2018-09-19 00:59

inthecity.gr | Τοπική Αυτοδιοίκηση inthecitygr

#inthecity | Ηλεκτρονικό στέκι για την Τοπική Αυτοδιοίκηση | Τουρισμός, Διεθνή, Πολιτισμός, Σπορ, Media | Βρείτε μας σε Facebook και YouTube!

Πρόεδρος του «Σταύρος Νιάρχος» η Λυδία Κονιόρδου

2018-09-19 00:59

Filathlos.gr filathlosgr

Συνεχής ενημέρωση από το πρώτο αθλητικό blog στην Ελλάδα. Μπείτε στη σελίδα μας στο

Γιάγια Τουρέ: "Πάμε να κερδίσουμε το Europa League..."

2018-09-19 00:59

15 minutes 15minutes_gr

Όλες οι ειδήσεις και τα τελευταία γεγονότα από το 15minutes.gr!

Συνάντηση Μητσοτάκη με Σαμαρά - Τι συζήτησαν -

2018-09-19 00:59

ΡΑΠΤΗΣ ΓΕΩΡΓΙΟΣ aktinraptis1

RT @MakisSinodinos: Ξεκίνησε η πορεία , στη κορυφή οι γονείς του #KillahP

2018-09-19 00:59

stathus stathusquo

Όλα είναι Χημεία

RT @BarbunZel: Ο 12χρονος Lukas πάσχει από μυϊκή δυστροφία και μπορεί να κουνήσει μόνο τα δάχτυλά του. Έτσι, ο ψυχολόγος και φωτογράφος Mat…

2018-09-19 00:59

fontas tsounis fontastsounis

Δημοσιογράφος, αθλητικού - στοιχηματικού χώρου με τηλεοπτική εκπομπή στο ACTION 24, αρθρογραφία σε εφημερίδες και προσωπικό site

@kostas5804 Δυστυχώς σε καμία από αυτές που δραστηριοποιούνται στην Ελλάδα. Έτσι νομίζω τουλάχιστον. Το είχε σίγουρ…

2018-09-19 00:59

desdenova(γιώργοςδεμίρ) geodem2000

ERT producer, ex AGOS and Athens News Agency reporter, RT ettigim seyelri destekledigim anlami tasimaz!

RT @DimoYagcioglu: Nazi Altın Şafaklılar tarafından öldürülen antifaşist rapçı Pavlos #Fyssas’ın ölüm yıldönümünde Batı Trakya’da faşizm ka…

2018-09-19 00:59

youck_fou youck_fou

Ουγκάγκα μπουμ μπουμ χι γκάπα γκουμ μπιρλί γκαγκά, αούγκιγκι αούγκιγκι μπάγκαλα γκάουγκα γκα. 

RT @AEK_FC_OFFICIAL: Μια από τις μεγαλύτερες νίκες στην ευρωπαϊκή ιστορία της ΑΕΚ σαν σήμερα, πριν από 33 χρόνια, στο ΟAKA. Την 18η Σεπτεμβ…

2018-09-19 00:59

Πετρος petros29eliz

RT @arisb1978: -πόσο είσαι;
-με παίρνει ο ύπνος απο τις 9
-συγνώμη δεν ήξερα

2018-09-19 00:59

naftemporiki.gr naftemporikigr

Ρεπορτάζ, multimedia, ειδήσεις από την Ελλάδα & τον κόσμο.

Πανελλαδική Επιτροπή Μπλόκων: Δε βολευόμαστε με ψίχουλα

2018-09-19 00:59

DimitrisChalkiadakis dchalkiada

Πήγαινε στις φυλακές και ρώτα τον Λούλα, μια που θάσαι εκεί.

2018-09-19 00:59

Pepe PepeCarpenter

\___📚___/---====

RT @Dunkel_Fee: Νομίζω οτι το άβαταρ πρέπει να κοιτάει η ευθεία στην κάμερα ή προς το τουι, όχι απο την άλλη, δεν ξέρω, γνώμη μου

2018-09-19 00:59

Reporter.gr reportergr

Αναλύσεις και ρεπορτάζ για την οικονομία, την πολιτική, το χρηματιστήριο. Email: info@reporter.gr - Facebook:

Συγκέντρωση για τα πέντε χρόνια από τη δολοφονία Φύσσα

2018-09-19 00:59