Tweets at Kallithea around 30km

It searches the Tweets of Twitter around Kallithea 30km.


Search Results

Ashlyn Davis ashlyn_d

Lindenwood University - Belleville '18

RT @LilMaddyImDaddy: My grandma is 69 years old and invited a man out on her boat with us today and before he arrived she said “i don’t lik…

2018-07-17 07:01

max klaftamana

We are the world. &src=typd&vertical=default&f=tweets #Taiji #AdoptDontShop #stopYulin #stopthebarbarians #Taiji

RT @olympiacosbc: Ο #OlympiacosBC θα λάβει μέρος στο τουρνουά της @cskabasket "Alexander Gomelsky Cup"

Σάββατο 29/09
Ολυμπιακός-Αναντολού…

2018-07-17 07:01

xris_to_s xris_to_s

Γατάκια..

RT @RenataMagl: Κανόνας 30ος:Δικαιωμά σου να υπάρχεις γύρω μου,δικαιωμά μου αν θα σε βλέπω

2018-07-17 07:01

Πετρος Σαχπερογλου petersachper

RT @DimitrisSotiri2: - Έκλεισα τελικά πτήση με Ryanair
- Πόσο;
- 25€ χωρίς αεροπλάνο

2018-07-17 07:01

FREEDY & BRUNA FREEDYBRUNA

ΚΑΤΟΙΚΙΔΙΑ ΖΩΑ ΕΝΟΣ ΠΟΛΙΤΗ ΤΗΣ ΕΥΡΩΖΩΝΗΣ. ΓΕΝΝΗΜΕΝΑ ΣΤΗΝ ΑΘΗΝΑ ,ΤΟ ΑΦΕΝΤΙΚΟ ΤΟΥΣ ΣΤΟ ΔΙΔΥΜΟΤΕΙΧΟ ΤΟ 1972.ΒΛΕΠΟΥΝΕ ΤΑ ΠΑΝΤΑ ΜΕ ΧΙΟΥΜΟΡ,ΧΙΟΥΜΟΡ ΚΑΙ ΧΙΟΥΜΟΡ.

RT @FREEDYBRUNA: #twitter_einai
σκόρπιες λέξεις
έξυπνες ατάκες
κλεμμένα tweets
ψευτικες αλήθειες
αληθινά ψεμματα
εικόνες με χιούμορ
σε 14…

2018-07-17 07:01

bar_outinio Barouti7

Η αγάπη θέλει bio

RT @dodosmpe: Τους καλοκαιρινούς μήνες καλό θα είναι να μην ακουμπιόμαστε χωρίς λόγο

2018-07-17 07:01

bar_outinio Barouti7

Η αγάπη θέλει bio

RT @S__Perfect: Θεε μου δωσε μου υπομονη,γιατι αν μου δωσεις δυναμη θα τα γαμησω ολα

2018-07-17 07:00

Atheism andykalav68

Realising fast Trump cult are too stupid to debate with.

@ElizabethRutti2 @realDonaldTrump You know he does not like black people and neither do most of his supporters. Mil…

2018-07-17 07:00

Ren MgLaren ® ♊ RenataMagl

B.I.T.C.H-Queen 2.

RT @ninetaoriginal: Αυτό που όλα μου περνάνε σε 2 μέρες είναι καλό αλλά και δεν είναι

2018-07-17 07:00

ΑΝΔΡΕΑΣ kakotaritis

RT @ifertakis: Πρώτα, εξέλεξαν αρχηγό πριν φτιάξουν κόμμα.
Τώρα, αναζητούν αγγελιοφόρους χωρίς να έχουν μήνυμα.
Θα καταλήξουν να ψάχνουν γι…

2018-07-17 07:00

Tourist Pavlos_C

Τα παιδία παίζει

RT @RenataMagl: Είμαι σε ηλικία που αν μου πατήσεις το λάθος κουμπί κλείνει αμέσως και ο γενικός διακόπτης

2018-07-17 07:00

⭐ Stavros Zakkas️ ️♒ StZakkas

I used to mix my Vinyls, then some Numbers, next the Communications, later some Data and Processes and now the Web. #eMarketing Consultant

Google Adwords Certification Study Guide – All You Need to Be Top of The Class >RETWEET

2018-07-17 07:00

Giorgos Karolos GiorgosKarolos

Αν είστε τίποτα τράπεζες ή εισπρακτικές εταιρείες μην χάνετε τον χρόνο σας μαζί μου.Έχω πάρει μόνιμη πτωχευπτική άδεια.🏊🍉🍺🚬

RT @RenataMagl: Κανόνας 30ος:Δικαιωμά σου να υπάρχεις γύρω μου,δικαιωμά μου αν θα σε βλέπω

2018-07-17 07:00

Thanos thanosvz

Mech/Eng

RT @Dionisis81: Υποψιάζεται κανείς ότι ο ΣΚΑΪ και ο ΑΝΤ1 αν είχαν πάρει τα δικαιώματα μετάδοσης του γεγονότος με την υψηλότερη τηλεθέαση το…

2018-07-17 07:00

Haley Mitchell PrincessHaley23

Yes, I am a PRINCESS ask my daddy or my boyfriend they will tell you!

Opening your mind to new ideas rocks your world. Messages will... More for Sagittarius

2018-07-17 07:00

Euthyphro EuthyphroOfPhx

Name and images appropriated from Greek culture without permission. POYB 2° The West is the Best. Pronouns: Excellency, His Excellency

@JDeWPerry @Rangerfan41 @AP I'm not going to waste any more time trying to explain the difference between an asylum…

2018-07-17 07:00

Giorgos Karolos GiorgosKarolos

Αν είστε τίποτα τράπεζες ή εισπρακτικές εταιρείες μην χάνετε τον χρόνο σας μαζί μου.Έχω πάρει μόνιμη πτωχευπτική άδεια.🏊🍉🍺🚬

RT @RenataMagl: Κανόνας 6ος: αν πιάσεις πάτο,γίνεσαι βράχος

2018-07-17 07:00

Athens Voice AthensVoice

Η μεγαλύτερη εβδομαδιαία εφημερίδα

Η Ζάκυνθος του Στέφανου Τσιτσιπά

2018-07-17 07:00

Iliodor E. Molossus IliodorM

Έλλην

@VelThorns Χριστιανισμός = πνευματικός κοινωνικός μαρξισμός

Μαρξισμός = μεταλλαγμένος χριστιανισμός

Τα Κοινά που…

2018-07-17 07:00

octavio rufu01

And in the end the❤you take is equal to the❤ you make

RT @mkatsiki68: Καλό βράδυ φίλοι μου!!!🌺💞🌺

2018-07-17 07:00

Aris Chatzistefanou xstefanou

journalist. For english visit

Φεστιβάλ Συνεργατισμού: CοOpenAir Festival

2018-07-17 07:00

Tootsie_Pop TahhhReese

People go with ANYBODY to say they got SOMEBODY 😂😂😂😂😂😂😂😂

2018-07-17 07:00

Stelios Christakis Stelios1978

Πούτιν: Ο Ψυχρός Πόλεμος έχει τελειώσει - Τραμπ: Η σχέση μας έχει αλλάξει

2018-07-17 07:00

ΝτουΒρουjazz GeorgeIris1

Το παρόν ακάουντ υπολειτουργεί...

RT @eleni_said: Η καλύτερη γκομενοπαγίδα τελικά δεν είναι να χεις σκύλο αλλά γκόμενα.

2018-07-17 07:00

epicurus epicuruslimitid

‏‏‏‏نعم الله لا تجدها الا عند الظالمين ومن يستغل اسمه وسخطه امتحان للمؤمنين وعدالته في جنه ونار لا يستطيع اثبات وجودهما احد.

@Almajlliss @Shai5a_albhawed شفيها البيتزا بالاناناس؟!!!

2018-07-17 07:00

Paul Redfern paulredfern

Professional amateur. Constantly curious. Always hungry.

RT @diioannid: World’s first living tattoo, #3Dprinted with real bacteria v/ @MikeQuindazzi

#3Dprinting #iot #tech #technology #innovation…

2018-07-17 07:00

Ο τρελός της πόλης Parafron4

Βλαμμένος κάφρος βρίζω κ στον ύπνο μου. Έχω μαύρη ζώνη στο μασάζ.ΠΑΟΚ ρε

RT @mikromary: | ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄|
Δέχομαι
απειλές να
κάνω τουί 😋
|___________|
(\__/) ||…

2018-07-17 07:00

Joaquín San José jsanjosea

Médico de familia y apasionado de la Nutrición

RT @nick_krontiris: Great TL;DR of what we've learned over the past years: The Impact of Exercise and Nutrition in the Regulation of Skelet…

2018-07-17 07:00

Владислав Козяк vladislavkozyak

Интересные фотографии Новости технологий Технология и наука Авторитеты из мира технологий Бизнес и финансы Мнение

RT @spiroseliot: Dogecoin vs Bcash
BCH transactions 24hr 16,595
DOGE transactions 24hr 22,196

BCH average block time 10m 59s
DOGE average…

2018-07-17 07:00

Greece Outside In GreeceOutsideIn

We collect news about Greece from all over the world

I Despised My Greek Beauty Features - Until Something Clicked #Greece #news

2018-07-17 07:00

Pavlos PavloEv

@lolalo24 @RedFanGirl7 Εντάξει, φετος,πέρσι,προπερσι,είμαι κ μεγαλος ανθρωπος δε τις παρακολουθω τις μόδες από τοσο…

2018-07-17 07:00

Ο τρελός της πόλης Parafron4

Βλαμμένος κάφρος βρίζω κ στον ύπνο μου. Έχω μαύρη ζώνη στο μασάζ.ΠΑΟΚ ρε

RT @mikromary: - που μένεις ;
- στη μπανιέρα

2018-07-17 07:00

Maria Efstathiou MariaEfstathioy

17🍒

'alo

2018-07-17 07:00

TAZ tazmanolis

Ιστορικό στέλεχος της κεντροαριστεράς της Τασμανίας

RT @Vkikilias: Παρακαλούνται οι αφισοκολλητές του ΣΥΡΙΖΑ να μην μετατρέπουν σε εργαλεία προπαγάνδας θεσμούς και σώματα ασφαλείας. …

2018-07-17 07:00

ε κ δ ο χ ή otra_version

λογομαχώ με τη σιωπή κι η σιωπή με νικάει

RT @paspar_tou: Ο εγωισμός μετράει πάντα αυτά που έδωσες.
Ποτέ αυτά που πήρες

2018-07-17 07:00

Stephany StephanyBibi1

When there is a will, there is always a way!

RT @isminouta: Μην ντρέπεστε να πείτε ότι είστε μαλακες. Εγώ δεν ντρεπομαι. Το λέω. Είστε μαλακες

2018-07-17 07:00

who is she _WhoIsShe__

just living life baby, RIP daddy 🌹

RT @LilMaddyImDaddy: My grandma is 69 years old and invited a man out on her boat with us today and before he arrived she said “i don’t lik…

2018-07-17 07:00

Giorgos Karolos GiorgosKarolos

Αν είστε τίποτα τράπεζες ή εισπρακτικές εταιρείες μην χάνετε τον χρόνο σας μαζί μου.Έχω πάρει μόνιμη πτωχευπτική άδεια.🏊🍉🍺🚬

RT @RenataMagl: Είμαι σε ηλικία που αν μου πατήσεις το λάθος κουμπί κλείνει αμέσως και ο γενικός διακόπτης

2018-07-17 07:00

newpost.gr newpostgr

Πολιτική, επικαιρότητα, οικονομία, κοινωνία, κόσμος: Eιδήσεις που αξίζει να γνωρίζει κανείς!

Ανάμεσά τους αγαπημένοι προορισμοί όπως η Λούτσα, ο Ωρωπός και ο Σχοινιάς

2018-07-17 07:00

σιροκοs σουλτανος του μακαου scirocco1908

💜 💚 @ch0colate_rain ουδείς ευεργετηθέτερος του ευεργετηθέτερου 🇲🇴

RT @CharmingAssh0le: | ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄ ̄|
Έχω τρία αρχίδια
|___________|
(\__/) ||
(•ㅅ•) ||
/…

2018-07-17 07:00

Ζωή tozoudio

Βρήκα το νόημα της ζωής στην πίτσα.

RT @eleni_said: Η καλύτερη γκομενοπαγίδα τελικά δεν είναι να χεις σκύλο αλλά γκόμενα.

2018-07-17 07:00

Nikitas P pnikitas1

RT @dflouda: Και αν κάτι δεν πήγε καλά σήμερα αύριο ξημερώνει μια καινούργια μέρα και όλα μπορεί να είναι καλύτερα!Καλό βράδυ παιδιά σε όλο…

2018-07-17 07:00

music musicfactorygr

twenty one pilots: Jumpsuit [Official Video]

2018-07-17 07:00

🥀Christina 🤺 Nina_teachergr

❣️”Η ομορφιά είναι στην καρδιά..”❣️ 🥀”Είναι ωραία να είσαι εδώ..” 🥀 Nightwish - The phantom of the Opera

RT @TheAbyssBeneath: Το μόνο πράγμα που δεν αλλάζει μεγαλώνοντας είναι αυτό που νιώθεις στην καρδιά σου όταν ακούς μουσική

2018-07-17 07:00

Garrett Bastardi garrettbastardi

PSU, gigem. when sports are on I tweet about it. professional golfer. Ephesians 1:11

RT @davidpollack47: A&M fans will love hearing this from their new coach. A&M hasn’t lack facilities or talent over the years but this... t…

2018-07-17 07:00

Provocateur iProvocateur

Ζωή και Εμπειρίες. Μυαλό και Σκέψεις.

"Ποιος Πλάτωνας μωρέ, ο βοηθός του Σωκράτη, ο αιώνιος μεταφραστής του Σάντος, έλα τώρα"...

2018-07-17 07:00

gazzetta.gr gazzetta_gr

Η καλύτερη δημοσιογραφική ομάδα του αθλητικού internet παίζει μπάλα εδώ!

Ο καλύτερος φίλος του ανθρώπου!

2018-07-17 07:00

ΝΕΝΑ ΧΡΟΝΟΠΟΥΛΟΥ nenaxronopoulou

ΗΘΟΠΟΙΟΣ-ΣΥΓΓΡΑΦΕΑΣ-ΣΤΙΧΟΥΡΓΟΣ

Δείτε πως είναι σήμερα ο Μιχαλάκης (γιος της Μάρως Λεονάρδου) από τη σειρά «Λατρεμένοι μου γείτονες»

2018-07-17 07:00

Nikitas P pnikitas1

RT @anastasiakaf: Καληνυχτουδια μας😉😉😴😴

2018-07-17 07:00

hc hch1979

RT @skaloumbakas: Χειρόγραφη επιστολή στα Αλβανικά, η οποια γράφει πώς κάποιος λοχαγός τού ΕΑΜ/ΚΚΕ παρέδιδε σέ Αλβανό εγκληματία, 150 καί β…

2018-07-17 06:59

Υπάλληλος της Βουλής 🥃☕️ AllazoToNero

Proudly blocked by @evenizelos,@panoskammenos , @gmourout,@papadimoulis,@evakaili, @karximakis,@failosK,@IliasKasidiaris, @kMitsotakis,@alsalech and counting...

RT @Charles_Coonz: A walk at Plato's digital museum. Broken floor, access traps etc makes the visit an unforgettable experience. Nice work…

2018-07-17 06:59

JohnMeLene JohnMeLene

Επειδή μεγάλωσες πιστεύοντας σε κάτι, δεν σημαίνει ότι είναι αλήθεια!!!

RT @anastasiakaf: Καληνυχτουδια μας😉😉😴😴

2018-07-17 06:59

Hlektra M ❤ mshlektra

❤ Instagram: mshlektra
❤ A woman can be beautiful as well as intellectual.

o seu perfil foi visto por 4 pessoas nas últimas 3 horas

2018-07-17 06:59

pan8iraki pan8iraki

RT @S__Perfect: -Καβλιάρα, θέλω να σε ξεσκίσω
-Πως μιλάς έτσι;
-Είμαι λίγο βραχνιασμένος, γι'αυτό

2018-07-17 06:59

Trevor Richardson trevrichuga

UGA Class of 2016 | Software Engineer

RT @ugabarstool: Georgia Tech Football Vs. Making a bowl game

2018-07-17 06:59

Daffy Orlandus maleaxel

Criticism may not be agreeable, but it is necessary. It fulfils the same function as pain in the human body. It calls attention to an unhealthy state of things.

RT @parodynews: Με δούρειο ίππο την Γκολεμά!

2018-07-17 06:59

Ghost Season Street Team GhostSeasonST

The Ghost Season Street Team twitter.














Follow @GhostSeasonBand

RT @GhostSeasonBand:

2018-07-17 06:59

BinDNA bindna

DNA Sequence Generator

GTTGTCTTCACGACGGAGCAATATCAATGTACTGGTTCAGACGTATGGATTGAAGCTTGAGTAACGCCCGTACCTTTTGTATCTCCGGCCGTAGTTCCTACTCTTGGCCGACATG…

2018-07-17 06:59

BinDNA bindna

DNA Sequence Generator

GTACTTTGTTCTGACGGGGGATGGTGGCGCAGCGTGTAAGCCGCACAGCAAAATAGCAACGCTCGTCGCCCTCCGTGTGGCATGCGCATAATAACTCGGGGAATCAACTAAAAGC…

2018-07-17 06:59

Durutti Degian durutti13

Γενικη πολιτικη followback εκτος αν εισαι και γαμω τα παιδια και σε ακολουθω ετσι κ αλλιως.. Σχολια για πουτσα(πολιτικη),μπαλα(ΠΑΝΑΘΑ) κ τραμπαλα (επικαιροτητα)

@triapentedyo @Pakisantreas

2018-07-17 06:59

BinDNA bindna

DNA Sequence Generator

GATTTTTAACACCTCCAAGCGTCCACTCCACATTGTGGCCGCGCGGCTAAAGTACCTACGGCTCGTTAGCGAAAAGGAGCTCATCGTCGCTCTATCCGAGCCACGGCGAGTGTTT…

2018-07-17 06:59

BinDNA bindna

DNA Sequence Generator

GTACCTTCAATCAAAGCCTTTGACGTCCCCCGAGTACATTCAATTAGTTGAGATCGGCCTAGCGAAATGCTGAAAAATTGAAAGAAGGTTAATGTTTGGAGCCTAGAGTAGCAGC…

2018-07-17 06:59

ΝiKi🌛 Phoebe1_

Just for fun. ✨🔮 (I miss the Old Twitter)

@oXHAZELXo @TouchByAM Yayy!!!

2018-07-17 06:59

vatzgr vatzgr

Project Manager - T&T UKI - NORDICS & DACH PMP®, ITIL®, PRINCE2®. SCRUM, Six Sigma Yellow Belt certified. Around the 🌍 Rt's not endorsement.

RT @anestis: @kiritsisgeorge1 @xarikliamaria Είναι ενδιαφέρον που τόσος κόσμος σου δείχνει το λάθος στο σκεπτικό και επιμένεις να θες να φα…

2018-07-17 06:59

Philippa Yova_stileto

Φοιτητρια κατα τα λεγομενα.
Ψυχακι του Grey's Anatomy στον ελευθερο χρονο μου

@ResidentFOX @jennadewan #NewFavoriteMedicalDrama 😊😍

2018-07-17 06:59

🔯Magissa Fourka✡️ dvanikioti

RT @toumvas: -Μωρό μου μολις ερθεις σου έχω μια έκπληξη.
-Πες μου τι, θα σκάσω!
-Ενα μόνο σου λέω: σε περιμένω να βουτήξουμε μαζί!
-ΕΦΤΙΑΞΕ…

2018-07-17 06:59

🐠 ΣΜΕΡΝΑ 🐠 smerna1979

#BoycottSeaworld #CaptivityKills #DontBuyATicket 🐬💙🐬 🐳💙🐳 🦈💙🦈

RT @TaZwaMouArga: Είναι και κάτι μάτια... που, όσο και να το θέλουμε, δεν ξεχνιούνται

2018-07-17 06:59

Miss Christine 💫 christina_mar10

• Panteion University Department of Sociology🎓 • We came, we saw, we loved

RT @vlaxakolonakiou: Με τις λέξεις γίναμε όλοι καλοί και χαϊδεύουμε αυτιά και συνειδήσεις.

2018-07-17 06:59

Μέδουσα MforMedusa

🌙 romantic bastard 🌙

RT @VPetsopoulos: Τα καλύτερα μεθυσμένα μηνύματα τα σβήσαμε πριν τα στείλουμε

2018-07-17 06:59

Nineta81 ninetaoriginal

ΠΕΛΟΥΣΙΑ ΟΧΙ ΚΟΝΤΗ my love ~@gerrard8din my klika ~ @dtzampazis

Ε ρε που έμπλεξα πάλι ΠΑΩ ΝΑ ΓΡΑΨΩ ΒΙΒΛΙΟ ΠΡΙΝ ΜΕ ΣΦΑΞΟΥΝ τουλάχιστον να αφήσω μια κληρονομιά

2018-07-17 06:59

zaphod b aeisixtir

el diablo cazador des hombres

RT @mpaountolino: @Khlysty1 @EllNikos @ArkadIvanovich @aeisixtir @spigaro под вашими руками от наших македонцев

2018-07-17 06:59

Λουκρητία Νιάου En8JTBj2FBlPndg

🔀 Όλα είναι Δρόμος⛔ exclude:replies

RT @vlaxakolonakiou: Ότι πέφτετε στα μάτια μας με κάτι ξέκωλλα που ακολουθείτε στο ινσταγκραμ σας πέρασε ποτέ από το μυαλό αγόρια?

2018-07-17 06:59

🐠 ΣΜΕΡΝΑ 🐠 smerna1979

#BoycottSeaworld #CaptivityKills #DontBuyATicket 🐬💙🐬 🐳💙🐳 🦈💙🦈

RT @TaZwaMouArga: Παιδιά θα το ξαναπώ... Φόλοου μπακ κάνουμε, ΔΕΝ κάνουμε προγαμιαίο συμβόλαιο, ε;;;

2018-07-17 06:59

Miss Christine 💫 christina_mar10

• Panteion University Department of Sociology🎓 • We came, we saw, we loved

RT @TaZwaMouArga: Είναι και κάτι μάτια... που, όσο και να το θέλουμε, δεν ξεχνιούνται

2018-07-17 06:59

Badass elitepariah

RT @matthaiosleonid: Το σκυλάκι μας εδώ στο χωριό κυνηγάει την ουρά του και ξεφεύγει λίγο από την πλήξη του.

2018-07-17 06:59

Ανεπρόκοπος® Vrussanos

Από που μπήκα;

RT @TaZwaMouArga: Πάντως, για να είμαστε εδώ μέσα, ένα ψιλοπροβληματάκι το έχουμε, ε;;;

2018-07-17 06:59

bar_outinio Barouti7

Η αγάπη θέλει bio

RT @mikromary: - που μένεις ;
- στη μπανιέρα

2018-07-17 06:59

Vassilis Ntakoulas vdakoulas

#olympiacosveteransbc #olympiacosfamily #thrylos #Charitycame #ολυμπιακος #instapic #instalike…

2018-07-17 06:59

Aluminio Passions Aluminiopassion

Spartan Aluminum #Personalized #KeyChains, #bracelets and other #handmade Aluminum Items.

You Hold My #Heart In Your Hands #Keychain - #FREEShipping - #Personalized Keychain with drilled heart - Perfect Co…

2018-07-17 06:59

Josh Youngblood Yblood90

28 | Husband | Father

RT @ugabarstool: Georgia Tech Football Vs. Making a bowl game

2018-07-17 06:59

Red Riding Hood TheRedRHood

• Where's your will to be weird? JM •

RT @VPetsopoulos: Τα καλύτερα μεθυσμένα μηνύματα τα σβήσαμε πριν τα στείλουμε

2018-07-17 06:58

Mimis-13 bigapple_13

RT @reppasgiorgos: Όταν βιάζεσαι να βγεις πασαρέλα κ περνάς μέσα απ την πόρτα!!

2018-07-17 06:58

Dimitris Sotiriou DimitrisSotiri2

* Ένας φτωχός και απλήρωτος υπαλληλος * Άνοιξε το κλειστό σου μυαλό.. Κλείσε το ανοιχτό σου στόμα… Α! Και πράξε επιτελους

Η μόνη που μου ξεκουμπώνει το παντελόνι, είναι η κοιλιά μου

2018-07-17 06:58

Thalia Amargianou TAmargianou

Software Developer, athletics, my parents grill house in my village Paleros called: o giatros tis peinas! Marvel & DC Comics

2018-07-17 06:58

Kostas Kostas_Pls

Καθε περσι και καλυτερα.

RT @Dunkel_Fee: Ποτέ δεν ανοίγουμε σοβαρή συζήτηση κανενός είδους μετά τις 11μμ, ΝΟΜΟΣ

2018-07-17 06:58

TS0UKNIDA TS0UKNIDA

RT @sofiazacharaki: Δεν είναι δα και τόσο μεγάλο ζήτημα που τόσοι διαψεύδουν ότι υπέγραψαν το κείμενο στήριξης της συμφωνίας των Πρεσπών. Ε…

2018-07-17 06:58

ε κ δ ο χ ή otra_version

λογομαχώ με τη σιωπή κι η σιωπή με νικάει

RT @GeorgeoPikis: Η αποδοχή της έτερης ψυχής κατά το τρόπο που αυτή επέλεξε να είναι. Ανεκτίμητο.

2018-07-17 06:58

Panayiota PanaLuna33

Poetry. Art. Music. Photography.

"Perhaps the most "spiritual" thing any of us can do is simply to look through our own eyes, see with eyes of whole…

2018-07-17 06:58

Handmade With Love Greece HandMadeLoveGr

modern silver jewelry handmade in #Greece 🇬🇷 birthstone rings - wide silver rings, hammered jewelry designed by Eleni Pantagis

2018-07-17 06:58

DON NOVA DON_VAG_NOM

@therizo_thieles 💕 @mikros_prigkipa 🤜🤛

RT @TaZwaMouArga: Παιδιά θα το ξαναπώ... Φόλοου μπακ κάνουμε, ΔΕΝ κάνουμε προγαμιαίο συμβόλαιο, ε;;;

2018-07-17 06:58

شـ,ـيـ,ـنـ,ـكـ,ـو Khalil63723940

الصقر_صقر_يا_صاحبي_لو_المسافه_بعيده 🌎🗺😉

RT @BASMA55120013: والله بعد الصبر ربنااا بيكرمناا بحجات جميلةة✨

2018-07-17 06:58