Tweets at Kallithea around 30km

It searches the Tweets of Twitter around Kallithea 30km.


Search Results

ACIE versacie_

(SPO) Sapiosexually Pre-Occupied

@huertastisha Ayy, so dili pa diay ko dapat mabalaka. HAHAHAHAHAH

2018-09-20 09:38

Katerina!(...k- - -) KaterinaGreece2

I wiII do what I want,l go where l will,l stay as much as I want!

RT @VPetsopoulos: Ο άλλος κυκλοφορεί με σφυρίχτρα έτσι ώστε αν δει κανένα πέναλτι στο λεωφορείο να το σφυρίξει

2018-09-20 09:38

brittany brittttaannyy_w

i think witt should reimburse me for all the times i have eaten off campus because cdr food is so awful

2018-09-20 09:38

Vaskos VaskosMD

Μιλάτε έμορφα παρακαλώ

RT @syn_teleia: Εχουμε μαζεψει 30 κουπονακια για τηγανια και συνεχιζουμε, εντωμεταξυ εχουμε να τηγανισουμε στο σπιτι απ το '92

2018-09-20 09:38

ματθαίος matthaiosleonid

Πιστεύω στην @jk_rowling.

RT @matthaiosleonid: Να πάμε σε μια συναυλία των Mumford & Sons και να πεθάνουμε εκεί. Ευχαριστώ.

2018-09-20 09:38

Kimberly CaptainSwan_32

I love Colin O'Donoghue and CaptainSwan.I love watching WWE Wrestling, I'm a long time fan.I'm a fan of Seth Rollins,John Cena and Many More. I love Animals.

RT @coliferscoffeee: 💗

2018-09-20 09:38

ματθαίος matthaiosleonid

Πιστεύω στην @jk_rowling.

RT @matthaiosleonid: Θέλετε κι ευχαριστώ που μας καταστρέφετε; Ε άντε, ευχαριστώ.

2018-09-20 09:38

Mariam KaMal MARIAMK199

17’ UNWANTED PERSON

@Mirnakhaled25 حبيبي

2018-09-20 09:37

Augmented Eye m_ssingeye

Quiero que alguien se muera en mi funeral para que no sea tan incómodo ser el único muerto

RT @AlaxMaikal: TEST: ¿Eres extrovertido o inttovertido?

1. Eres más feliz:
a) Leyendo un libro en sábado noche arropado en tu cama con la…

2018-09-20 09:37

marianna mitta mariannamitta

Είμαι ψυχολόγος ,Συστημική-Οικογενειακή ψυχοθεραπεύτρια. Μπορείτε να βρείτε όλα τα άρθρα μου στο blog μου.

Δεν φταίνε τα παιδιά που είναι "ψώνια", οι γονείς φταίνε. Μια αληθινή ιστορία από το σχολείο της κόρης μου που δεν…

2018-09-20 09:37

Gianis Parios FC GiannisPariosFC

Giannis Parios Fan Club Singer/Songwriter

Χρονοντούλαπο: Η Κατερίνα Κούκα σε μια συνεργασία - έκπληξη με Πάριο και Μαντώ ! -

2018-09-20 09:37

🔸eclipsa Azuiza

all will bathe in the prettiest of flames 🔥 Doll Collector ✨ KH / Overwatch / Smite ✨ ♈ ENFP-T 》11.09 ⭐ witchcraft 🌕 moon is falling 《 Bae #2

RT @AlaxMaikal: TEST: ¿Eres extrovertido o inttovertido?

1. Eres más feliz:
a) Leyendo un libro en sábado noche arropado en tu cama con la…

2018-09-20 09:37

Paula♀ HastaElChocho_

Bisexual. Si no vas a amar sus demonios, no intentes sacarla del infierno. Libre, yo solo quiero ser libre. Mis Gatitos. Real. Octavia ♀ @zorradepresiva_

RT @AlaxMaikal: TEST: ¿Eres extrovertido o inttovertido?

1. Eres más feliz:
a) Leyendo un libro en sábado noche arropado en tu cama con la…

2018-09-20 09:37

ArchitectT TriantafylliaP

Civil Engineer-Monuments' Restorer-Architect-Lover of Art, Fashion, Science, Philosophy, Literature, Classic Music & every other interesting field of knowledge.

Nathaniel Kahn (1962-today): Cinematographer
Work: "My architect" documentary (2003)

2018-09-20 09:37

🅹🅾🅷🅽_🅰🆁🅽🅰🅻🅳_1979 Gianarnaldo79

❤️❤️💓💓💗💗💝💝💖💖

RT @analysigr: Την Καλημέρα μου σε όλους εσάς.
Ας προσπαθήσουμε να δούμε την ζωή μας από θετική της οπτική γωνία.

2018-09-20 09:36

🗝 Shadow Revelator ShadowRevelator

θέλω να γίνω πορνοστάρ! 🎬😈 Τριφυλλάρα☘Ρομαντικούλης🌹Leo ♌Fetishist 👠 Freelance Photographer📷- Activist - Volunteer - Performance - Actor🎭Indie Rock🎸Poetry✍️

@itsqueenmary12 Αυτή είναι καλός τρόπος να μην σου βάλει κακό βαθμό, και να δικαιολογηθείς!

2018-09-20 09:36

Mariam KaMal MARIAMK199

17’ UNWANTED PERSON

@Mirnakhaled25 ممكن بتختلف من شخصيه لشخصيه في امهات كتير صحاب لعيالهم مهما كان السن بينهم بس انا ضد جواز البنت وهي…

2018-09-20 09:36

ΝΑΠΑΛΜ ΣΤΟΝ ΓΡΑΜΜΟ THANASISGIOF

To the gullag my friends....

RT @silaserafim: Κρατουσε διπλα βιβλια, στοχοποιει και δινει προσωπικα στοιχεια αντιφρονουντων, απεχθανεται τα ΜΜΕ και θελει να καταργησει…

2018-09-20 09:36

belagile 🕷 LuciaDiamonds2

I only love my bed and my momma, I'm sorry

RT @AlaxMaikal: TEST: ¿Eres extrovertido o inttovertido?

1. Eres más feliz:
a) Leyendo un libro en sábado noche arropado en tu cama con la…

2018-09-20 09:36

spiroseliot spiroseliot

(lost in space ( Intergalactic Negotiation Society ( 1HeyFM6xMpq8s7BahqEuNPcTedDjhNUsoc ( 4411 804B 0181 F444 ADBD 01D4 0664 00E4 37E7 228E ))))

@SallyMayweather The worst thing about this pic is the other guys around him that no one care to wake up him and wa…

2018-09-20 09:36

BinDNA bindna

DNA Sequence Generator

TTCCTTCACCTTCTCCATTCCTCAGGCTCGCGTGGGTCGAGTATAGGTGGACCCGCGTCGTGGACCGGTGCGGAAGAAGCAATAGCCAAACAAGCAAGTGCGGTCGGAGTAACGT…

2018-09-20 09:36

Skywalker.gr skywalker_gr

Σημείο συνάντησης εργοδοτών και υποψηφίων στην Ελλάδα, με την πληρέστερη μηχανή αναζήτησης εργασίας. #skywalkergr #kanonikesdouleies

Εργαστείτε στην εταιρία RANDSTAD #skywalkergr #aggeliesergasias #ergasia

2018-09-20 09:36

BinDNA bindna

DNA Sequence Generator

CGGGGTCGATGGGAGGACTAGAGGATGTAAGAACTCTAAGGATCTCGTCCGTTACCGATATCTCCCGCGTAAAGCATGAGTCTTACCTCCTCTAGATTAAGAGCAAAACCTAGAG…

2018-09-20 09:36

BinDNA bindna

DNA Sequence Generator

TTCCCACTAACAATCTGGTATTTCCGCTTTAGAGCAACACTCACAAACCGGCTACCTGCACATGGCAACAAAGGCATTCCTTCTGGAGATCGCTAGAGTCAGGCCTTCGGTATTA…

2018-09-20 09:36

🇬🇷SpyTheGreek🇬🇷 SpyTheGreek

Admin at Fifa Mobile Facebook group(310k+ members),
Former owner of'Team Of The Game'league in Fifa Mobile,
NBA LIVE 18 Fanatic/PS4 Pro
Opinions are my own,thx

@mmahar @Eddie_Jay92 @CornellGunter Thank you keep us informed 👍

2018-09-20 09:36

la li lu le lo uselessSOAB

blue AF/ también soy CIDEB/ encargado de forzarla/chill af/struggling through existence pero muy optimista/

RT @AlaxMaikal: TEST: ¿Eres extrovertido o inttovertido?

1. Eres más feliz:
a) Leyendo un libro en sábado noche arropado en tu cama con la…

2018-09-20 09:35

TheCryptorider _Vas_Panagiotis

Love to ride 2 wheels , love Martial Arts (specially Wing Tsun) love to research and invest in Cryptocurrency ;)

Ecash's Inventor Is Back – And He Thinks He's Built the Fastest-Ever Blockchain via @CoinDesk

2018-09-20 09:35

salman köse kse_salman

RT @PrintsProject: Abstract alcohol ink painting by @PrintsProject on @FineArtAmerica | /> #abstractpainting #contempo…

2018-09-20 09:35

David Bishop coachbishop1

Follower of Jesus, Husband to Dawn, Father to Taylor and Rachel, father in law to Chase and Head Coach of the North Hall Trojan Football team

RT @davidpollack47: 12 years ago today my World was forever changed. Everything I grew up wanting to be was taken away in one hit. Never do…

2018-09-20 09:35

greco_gamer gamer_greco

Greek Sony-Nintendo🎮🕹 Gamer,Photographer Cosplay 📷,Gaming-News, Facts,Game Historian and Retro fan.📼💾 "Be Creative in your Life

Latest News PlayStation Classic will be available on the stores this December. .
.
Follow @greco_gamer for daily co…

2018-09-20 09:35

👽 Matiaspetrucci

So save me, I don't wanna be alone.

RT @AlaxMaikal: 4. Tu postura sexual favorita es:
a) Una orgía con 40 personas mientras hablas de tu vida.
b) Masturbarte con canciones rom…

2018-09-20 09:35

🗝 Shadow Revelator ShadowRevelator

θέλω να γίνω πορνοστάρ! 🎬😈 Τριφυλλάρα☘Ρομαντικούλης🌹Leo ♌Fetishist 👠 Freelance Photographer📷- Activist - Volunteer - Performance - Actor🎭Indie Rock🎸Poetry✍️

@itsqueenmary12 Συγχωρεμένη αγαπητή μου εγώ θα της έβαζα καλύτερο βαθμό και θα έλεγα σε καταλαβαίνω τα ίδια έχω περ…

2018-09-20 09:35

Alan McNeer amcneer

National Sales Assistant at WNDU-TV

RT @davidpollack47: Enjoyed it my man! Thanks for having me.

2018-09-20 09:35

pistepseto pistepseto

😋

H φέτα είναι το Αρχαιότερο τυρί του κόσμου και η απόδειξη βρισκεται στην Οδύσσεια

2018-09-20 09:35

Debbie 💫 debbiesodope

RT @deannvcd: vote juan for homecoming dukes‼️😉

2018-09-20 09:35

newpost.gr newpostgr

Πολιτική, επικαιρότητα, οικονομία, κοινωνία, κόσμος: Eιδήσεις που αξίζει να γνωρίζει κανείς!

Δημοσκόπηση MRB: Πρωτιά ΝΔ με 8,8 ποσοστιαίες μονάδες - Ποιος κέρδισε τη μάχη της ΔΕΘ

2018-09-20 09:35

Ηlektra hlektra_kom9

Ιt's my way...

RT @EGrettou: Έρχεται η άλλη στο φαρμακείο και με ρωτάει "το χάπι της επόμενης μέρας,μπορώ να το πάρω απο την προηγούμενη;"Μαζέψτε τις ρε,θ…

2018-09-20 09:34

Radio Mikrasiatis Mikrasia_Radio

Ραδιόφωνο για μερακληδες...

#NowPlaying on #Mikrasiatis_Radio
Κωνσταντινούπολης - Μηλίτσα που 'σαι στο γκρεμό

2018-09-20 09:34

Thanos Maltas authorgr

Μου άρεσε ένα βίντεο @YouTube ΣΕΦΕΡΛΗΣ - ΑΛΛΟΣ ΓΙΑ SURVIVOR - ΟΠΑΔΟΙ

2018-09-20 09:34

TheCryptorider _Vas_Panagiotis

Love to ride 2 wheels , love Martial Arts (specially Wing Tsun) love to research and invest in Cryptocurrency ;)

Newsflash: Japanese #Cryptocurrency Exchange Zaif Hacked, $59 Million in Losses via @cryptocoinsnews

2018-09-20 09:34

lela mpi_lela

RT @BlackOlgitsa: Αν δε μπορείς να συγχωρέσεις ένα ελάττωμα του άλλου,αυτόματα προδίδεις ενα δικό σου..το ότι δεν δέχεσαι τους ανθρώπους όπ…

2018-09-20 09:34

Katerina!(...k- - -) KaterinaGreece2

I wiII do what I want,l go where l will,l stay as much as I want!

RT @argie810: /> 🌺💕🌷💗🌷💕🌺

2018-09-20 09:34

Prince Rome PTI {{{ 🇵🇰💖🇬🇷 }}} PrinceRomepk

I Love my country Pakistan {{{💖@ImranKhanPTI💖}}}

@MuntahaKhaan Inshaa Allah

2018-09-20 09:34

James Martin gamebirddoc

Father | Husband | Graduate student wrangler | Associate Prof. UGA | in search of the best breakfast sausage | Retweets/likes don't equal endorsements

@MaerzLab We use crayons.

2018-09-20 09:34

Skywalker.gr skywalker_gr

Σημείο συνάντησης εργοδοτών και υποψηφίων στην Ελλάδα, με την πληρέστερη μηχανή αναζήτησης εργασίας. #skywalkergr #kanonikesdouleies

Εργαστείτε στην εταιρία EMERGY PRODUCTS AE #skywalkergr #aggeliesergasias #ergasia

2018-09-20 09:34

Η Απέχαλη MilValia

RT @CharmingAssh0le: Στον κόσμο μου υπάρχουν μονοκεροι, δεινόσαυροι, ουράνια τόξα στα οποια μπορείς να κανεις τσουλήθρα και όλα πάνε όπως θ…

2018-09-20 09:33

spiros kadarelis spirellis21

Handyman 💀☠️👻🤟🤟🤟👅👅👅

Μου άρεσε ένα βίντεο @YouTube Melvins-A History Of Bad Men

2018-09-20 09:33

Natalie Frazer natalie_frazer

RT @ugabarstool: Our #SmokeShowoftheDay is Ellie Holt. The account with the most RTs receives $100 for their contestant. Help Ellie out, Da…

2018-09-20 09:33

Vaso con sadpatillas grupodelwhatsap

Soy un estorbo y todo es mi culpa. Ana, 19 de enero. The memory remains.
Artes Escénicas 🎭.
Guapan't. |-/ !
Fer ❤. #420squad.
cuenta limit: @VasitoLimit

RT @AlaxMaikal: TEST: ¿Eres extrovertido o inttovertido?

1. Eres más feliz:
a) Leyendo un libro en sábado noche arropado en tu cama con la…

2018-09-20 09:33

ACIE versacie_

(SPO) Sapiosexually Pre-Occupied

@huertastisha Hoy, okay ra ka?

2018-09-20 09:33

Pericles Harry Yannakopoulos PYannakopoulos

Earthling on a contractual basis

@jordanbpeterson right on Jordan

2018-09-20 09:33

Katerina!(...k- - -) KaterinaGreece2

I wiII do what I want,l go where l will,l stay as much as I want!

RT @mkatsiki68: Να έχετε ένα όμορφο βράδυ.
Καληνύχτα.🌺💕🌺

2018-09-20 09:33

Katerina!(...k- - -) KaterinaGreece2

I wiII do what I want,l go where l will,l stay as much as I want!

RT @TsakiriTheodwra: Καληνυχτα στην παρέα μας♥ Σε όλους Καλό ξημερωμα με καλά νέα ♥

2018-09-20 09:32

Amburrr💉🧡 amburrhope

All orange everything 🧡 Jesus Follower. Mother. PhD in Sass. Science Nerd. Nursing Student. Be the Change ❤️

@shawneescissom Same.

2018-09-20 09:32

Vape Traveller vapetraveller

Vape & Chat! – The Scots Review

2018-09-20 09:32

J K MrGreen57

RT @davidpollack47: Enjoyed it my man! Thanks for having me.

2018-09-20 09:32

CryptoChain News CryptoChainBot

I retweet #blockchain | Follow to get the latest on #blockchain | By @_sidharth_m_

RT @fotis_kosmatos: @kmitsotakis⁩, US Ambassador ⁦@USAmbPyatt⁩, ⁦@AmChamGr⁩ president ⁦@simos_a⁩ and ⁦@IBM_Hellas⁩ General Manager Spyros P…

2018-09-20 09:31

Δε Lord by_Ron_t

Όταν μιλάει η μουσική σκάσε..

RT @juicykoutsour: Γιου νοου γουατ παιδια όλοι θα πεθανουμε μια μέρα ρε σκατοψυχαδες του ελέους.

2018-09-20 09:31

Tanner Brown TanBrown11

Future DPT. Just a guy trying to make my parents and our Lord proud. Tyler Simmons was onside.

RT @ugabarstool: Mood all week:

2018-09-20 09:31

David Pollack davidpollack47

Faith. Family. Sports. | Find me on @ESPN, @CollegeGameDay and @ESPNCFB Live. | Follow my family's foundation @PollackFF | #PollackFF #EveryDayCounts™

Enjoyed it my man! Thanks for having me.

2018-09-20 09:31

Tykeisha Jones Tykeishaj15

•Mind your own biscuits, and life will be gravy• •SC: tykeisha15•

It’s so funny watching people’s face when I take my industrial piercing out.

2018-09-20 09:31

Raquel Jacobs RaquelJacobs80

Stop Here Send Email

RT @fotis_kosmatos: @kmitsotakis⁩, US Ambassador ⁦@USAmbPyatt⁩, ⁦@AmChamGr⁩ president ⁦@simos_a⁩ and ⁦@IBM_Hellas⁩ General Manager Spyros P…

2018-09-20 09:31

Alison Smith lamsmith_smith

RT @davidpollack47: 12 years ago today my World was forever changed. Everything I grew up wanting to be was taken away in one hit. Never do…

2018-09-20 09:31

Juliana Assis JulianaAssisG

Hello! I am Juliana, PhD student in Bioinformatics.

@darrrnit @RSGBrazil s2 s2 Muito legal mesmo ver o grupo crescendo! #orgulho

2018-09-20 09:31

blueshiv blueshiv1

Σιχαίνομαι το Shushi & τον ΣΥΡΙΖΑ Την έξοδο απο τα μνημόνια την έκλαψα πίνοντας Belvedere Unfiltered Εσένα πάλι σε έκλαψα με ρετσινα...

RT @YiannisLoverdos: Ενα αθώο κορίτσι, η Μαρία, δέχτηκε φωτοβολίδα στ κεφάλι από ακροαριστερούς εξτρεμιστές, που διαδήλωναν για δολοφονία Φ…

2018-09-20 09:31

BinDNA bindna

DNA Sequence Generator

TGACCGTTTCATCAAGCGAACCACTTGGGTAGTTTGCAGATGGGGGCCAGAGTACCCGATACTTTGTTGAAGGCGCTTCACATCGTTACGGTCGATCTGGACTCTATATGAAATA…

2018-09-20 09:31

BinDNA bindna

DNA Sequence Generator

AAAATTACGCAGGCTTGCAAGGGTGGTCTGTCCGCCTACAGGTGTGCTCCGACTCTCGGCTAAATTGAAATGTTGATTTATGTCGCGGTAGACTGGTCATATTAAGTCAACTGAA…

2018-09-20 09:31

Dimitrios Masialas DimitriMasialas

Helping businesses to improve or build value proposition from Renewable Energy Sources and Saving

The Next #Marketing Skill You Need To Master: Touch

2018-09-20 09:31

Panos Kakaraskalis panosmyself

Singer/Musician/Songwriter

Μου άρεσε ένα βίντεο @YouTube Μάρκος Σεφερλής - Ο μάγος του ροζ (

2018-09-20 09:31

Η Απέχαλη MilValia

RT @AlikiKokkinou: Τόσο έχει προχωρήσει η τεχνολογία, μια πραγματικά αθόρυβη ηλεκτρική σκούπα χάθηκε ο κόσμος νσ βρουν;
Αααα!!! Και έναν αθ…

2018-09-20 09:31

korina kori_lz

💚Panathinaikos🍀
If opportunity doesn't knock, build a door!!!

@Giannis_Vl @drazen_11 @mariakouklakh @AnnaTh_9 @eniiii2 Καληνύχτα😊😊

2018-09-20 09:30

Amburrr💉🧡 amburrhope

All orange everything 🧡 Jesus Follower. Mother. PhD in Sass. Science Nerd. Nursing Student. Be the Change ❤️

@neylandmafia I’ve been on a Hard MJ & Whitney kick lately. Say almost daily that I wish I was born 15 years earlie…

2018-09-20 09:30

Βασιλειος Φλωρος FlorosVasileios

ΑΝ ΣΤΗ ΖΩΗ ΜΑΣ ΕIΧΑΜΕ ΤΑ ΠΑΝΤΑ.... ΘΑ ΜΑΣ ΕΛΕΙΠΕ ΤΟ ΤΙΠΟΤΑ.!!!

2018-09-20 09:30

Pericles Harry Yannakopoulos PYannakopoulos

Earthling on a contractual basis

@nabuccodenazzar @jordanbpeterson

2018-09-20 09:30

Rodolfo Alfredo Rodofredo2

Amante de la literatura, la música, el cine, y los buenos vinos. Economista interesado en los procesos sociales, la filosofía y la cultura universal.

RT @2018Ria: "The Earth is art, the photographer is only a witness." 🍂🍁💛
- unknown

#photography by Yann Philippe

2018-09-20 09:30

♥️RüYus♥️ Eli_AsFer

AsFer 💚 AzCen 💛 RüYus 💙 CanEm 💜

RT @sukruozyildiz01: NEFES NEFESE YOU NEVER LET ME DOWN!!!GOOD NIGHT EVERYONE
@SukruOzyildiz #NefesNefese #MelisaŞenolsun #SevdiğimUğruna…

2018-09-20 09:30

Βασιλειος Φλωρος FlorosVasileios

ΑΝ ΣΤΗ ΖΩΗ ΜΑΣ ΕIΧΑΜΕ ΤΑ ΠΑΝΤΑ.... ΘΑ ΜΑΣ ΕΛΕΙΠΕ ΤΟ ΤΙΠΟΤΑ.!!!

2018-09-20 09:30

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @WelcomeTweets: "BraveNewWorld" #MusicVideo #LPBband #Universal #Music Made in #Greece Dedicated to #aldoushuxley #RogerWaters https://…

2018-09-20 09:30

Niki Karagianni gynaikesmegoves

Γυναίκα .... Ελληνίδα ...έχω φτιάξει και μια σελίδα στο facebook για αυτό που λατρεύω. Follow me και θα σε κάνω και εγώ...

Πόσο βοηθούν τα παντζάρια την υγεία σας

2018-09-20 09:30

Niki Karagianni gynaikesmegoves

Γυναίκα .... Ελληνίδα ...έχω φτιάξει και μια σελίδα στο facebook για αυτό που λατρεύω. Follow me και θα σε κάνω και εγώ...

HOW TO UNDERSTAND YOUR CAT BETTER

2018-09-20 09:30

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: #Πρόγνωση Καιρού #Αθήνα #Αττική #Θεσσαλονίκη #ΕΛΛΑΔΑ - ο #ΚΑΙΡΟΣ σε κάθε πόλη - #ΕΚΤΑΚΤΑ #ΔΕΛΤΙΑ

2018-09-20 09:30

ΝΕΝΑ ΧΡΟΝΟΠΟΥΛΟΥ nenaxronopoulou

ΗΘΟΠΟΙΟΣ-ΣΥΓΓΡΑΦΕΑΣ-ΣΤΙΧΟΥΡΓΟΣ

8 πράγματα που θα συμβούν στο σώμα σας αν αρχίσετε να τρώτε μέλι κάθε μέρα -

2018-09-20 09:30

Lou Lou_Rid

i have nothing to say

RT @EGrettou: Έρχεται η άλλη στο φαρμακείο και με ρωτάει "το χάπι της επόμενης μέρας,μπορώ να το πάρω απο την προηγούμενη;"Μαζέψτε τις ρε,θ…

2018-09-20 09:30

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: Ο #σεισμός τώρα - Παρακολούθηση σε πραγματικό χρόνο από το #Γεωδυναμικό #Ινστιτούτο #Εθνικού #Αστεροσκοπείου #Αθηνών …

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: #OnlineRadioStations - Select #MusicStyle #Jazz - #Rock - #DubTechno - #Industrial Pop-up player nonstop listening! …

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @WelcomeTweets: #Πρόγνωση Καιρού #Αθήνα #Αττική #Θεσσαλονίκη #ΕΛΛΑΔΑ - ο #ΚΑΙΡΟΣ σε κάθε πόλη - #ΕΚΤΑΚΤΑ #ΔΕΛΤΙΑ

2018-09-20 09:29

Βασιλειος Φλωρος FlorosVasileios

ΑΝ ΣΤΗ ΖΩΗ ΜΑΣ ΕIΧΑΜΕ ΤΑ ΠΑΝΤΑ.... ΘΑ ΜΑΣ ΕΛΕΙΠΕ ΤΟ ΤΙΠΟΤΑ.!!!

2018-09-20 09:29

Lau loves Shawn ♔ sempreumarocher

“With great power comes great responsability.” Hogwarts graduate. Full time witch now. I’m not mundane.

RT @NektariaLp: You like it this @ShawnMendes 😍😍

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: #OnlineRadioStations - Select #MusicStyle #Jazz - #Rock - #DubTechno - #Industrial Pop-up player nonstop listening! …

2018-09-20 09:29

Βασιλειος Φλωρος FlorosVasileios

ΑΝ ΣΤΗ ΖΩΗ ΜΑΣ ΕIΧΑΜΕ ΤΑ ΠΑΝΤΑ.... ΘΑ ΜΑΣ ΕΛΕΙΠΕ ΤΟ ΤΙΠΟΤΑ.!!!

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @WelcomeTweets: #Πρόγνωση Καιρού #Αθήνα #Αττική #Θεσσαλονίκη #ΕΛΛΑΔΑ - ο #ΚΑΙΡΟΣ σε κάθε πόλη - #ΕΚΤΑΚΤΑ #ΔΕΛΤΙΑ

2018-09-20 09:29

Evdokia..!🌸 EudokiaGr1

Fangirling & overreacting 24/7¦ 18¦ anime¦ otaku¦ KPOP TRASH¦ I'm silly, bear with me a little bit more🖤🔥

Sweet talk to me babe
It’s magical
Sweet lullaby

#Lullaby_GOT7

2018-09-20 09:29

mommy shittitme

idek what I'm doing with this account

it's crazy how conspiracy theories can make you want to kill urself

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @WelcomeTweets: Ο #σεισμός τώρα - Παρακολούθηση σε πραγματικό χρόνο από το #Γεωδυναμικό #Ινστιτούτο #Εθνικού #Αστεροσκοπείου #Αθηνών htt…

2018-09-20 09:29

♥️RüYus♥️ Eli_AsFer

AsFer 💚 AzCen 💛 RüYus 💙 CanEm 💜

RT @sukruozyildiz01: The best episode ever...The scene between Ayaz and Sultan exquisite!!!
@SukruOzyildiz #NefesNefese #MelisaŞenolsun #Se…

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: #Πρόγνωση Καιρού #Αθήνα #Αττική #Θεσσαλονίκη #ΕΛΛΑΔΑ - ο #ΚΑΙΡΟΣ σε κάθε πόλη - #ΕΚΤΑΚΤΑ #ΔΕΛΤΙΑ …

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: #AntikytheraMechanism: This device is just extraordinary, the only... #Μηχανισμός των #Αντικυθήρων #HELLAS #ΕΛΛΑΔΑ …

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @LPBband: #Πρόγνωση Καιρού #Αθήνα #Αττική #Θεσσαλονίκη #ΕΛΛΑΔΑ - ο #ΚΑΙΡΟΣ σε κάθε πόλη - #ΕΚΤΑΚΤΑ #ΔΕΛΤΙΑ

2018-09-20 09:29

Γεωργία - gio gioskal

RT @zoosos: Μια εξαιρετικά ταλαιπωρημένη #αλεπού πήγε στο 8ο Νηπιαγωγείο Κορυδαλλού Αττικής (βίντεο)

2018-09-20 09:29

Welcome Tweets WelcomeTweets

Expanding Twitter Experience.

RT @WelcomeTweets: #AntikytheraMechanism: This device is just extraordinary, the only... #Μηχανισμός των #Αντικυθήρων #HELLAS #ΕΛΛΑΔΑ https…

2018-09-20 09:29