Tweets at Kesariani around 30km

It searches the Tweets of Twitter around Kesariani 30km.


Search Results

Ioannis Frantzis Minardos dementedmaggot

My Name is Ioannis Frantzis Minardos aka Jon Richard Mineiro. Brutal Death Metal vocalist for Womb Of Maggots. I am Inspired by Idiocracy and Humanity's Decay.

I just earned the [Many Missions] Achievement! #Warcraft

2018-06-25 09:08

Πέτρος Παραδοσιακός Paradosiakos64

Η Ιστορία του Παγκοσμίου Κυπέλλου: «Παγκόσμιο Κύπελλο 1994»

2018-06-25 09:08

thanos thanos2422

Even a stopped clock gives the right time, twice a day

RT @EvangAntonaros: Τον καυμένο τον Αντωνάκη.
Ακομη δε χώνεψε πως έχασε ανεπιστρεπτι την εξουσία που δεν του άξιζε!

2018-06-25 09:08

Tελεία και Παύλα vre_Katerina

Μια ρομαντική ρεαλίστρια.

Ανοίξτε κανα κρασάκι να πιούμε ρε γύφτοι

2018-06-25 09:07

layne laynewoodworth

I can't swim

RT @kaylaaahamilton: 4⃣skin

2018-06-25 09:07

prozac prozac006

so whats it gonna be?

RT @vlaxakolonakiou: Σαφέστατο νομίζω

2018-06-25 09:07

Leisl Kaberry Lawfabex

Aussie wife and mother of 4. LDS, Studying a degree in Criminology and #writer of teenage #fantasy adventure. #FSFNetwork

RT @FrostieMoss: Sofia wasn't looking for love in Corfu... #IARTG #mgtab #mustreads

2018-06-25 09:07

Leisl Kaberry Lawfabex

Aussie wife and mother of 4. LDS, Studying a degree in Criminology and #writer of teenage #fantasy adventure. #FSFNetwork

RT @FrostieMoss: Five Temples of Mythic #Greece #gods #goddesses #myths

2018-06-25 09:07

Bombay GordoneBombay

COYS!!! ATLUTD!!!

@MaddieMcCann23

2018-06-25 09:07

Jordan jomoskwiak

the drama... the poise ..!

RT @bjennymontero:

2018-06-25 09:07

sylvia selfman sylviaselfman

Author of the Izzy Greene Cozy Mystery Series. Check out COZY MYSTERIES TO DIE FOR at

RT @AngelSefer: 📕
Heirs to an incredible fortune are mysteriously dying one by one.
A sexy reporter and an enigmatic detective confront eac…

2018-06-25 09:07

Effrosyni Moschoudi FrostieMoss

Greek writer, book/travel blogger, film buff, Corfu lover, perveyor of #Greek #recipes. Visit my site for FREE books, guide to #Moraitika #Messonghi #Corfu

Sofia wasn't looking for love in Corfu... #IARTG #mgtab #mustreads

2018-06-25 09:07

halle HaleTlgr

RT @2018Ria: “Living is Easy with Eyes Closed.”
― John Lennon

#sculpture #artist Shawn E. Phillips

2018-06-25 09:07

Lord Rod. Leo13Rod

°I make vines°
°Follow me on instagram @leo13rod°
°Athens, Greece°

Μου άρεσε ένα βίντεο @YouTube The Mamas & The Papas: California Dreamin'

2018-06-25 09:06

Vaso_Z Vaso_Zzz

RT @toumvas: Σηκώθηκα έφτιαξα καφεδάκι έβαλα το μαγιό μου, αντηλιακό, άναψα το τζάκι κ κάθομαι κοντά στη φωτιά να πάρω χρωμα.

2018-06-25 09:06

Kyriakos Georgiou sv1kwz

3h Kyriakos Georgiou: Temp. 21 °C, Hum. 64 %, Bar. 1017.3 hPa, Rain 0 mm, Wind 5 km/h NE #Weathercloud

2018-06-25 09:06

The Duke john_wayne_gr

Churches and dictators, politics and papers, everything crumbles sooner or later

Αν ο Κυριακος ειναι σοβαρος, ο επομενος Προεδρος της Δημοκρατιας πρεπει να ειναι ο Σταυρος Δημας. -
@kmitsotakis @AdonisGeorgiadi

2018-06-25 09:06

Ανθή anthianthia

Διδάσκω την πιο όμορφη γλώσσα του κόσμου 📚
(ταπεινό ακκάουντ)

RT @vre_Katerina: Αργυρέ έγινες καύλα που το πήρες με την ξυριστική το μαλλί και αυτή η κοπέλα που παίζει στο κλιπάκι το νέο, τρελό μουνί.Κ…

2018-06-25 09:06

圭衣子 けいこはん。 keico_my_c

My faith, religion: Catholicism。 The interested one give me a message.

RT @ATHNICO: I don't know when my Lady...Maybe our children, maybe our grandchildren...but someday...Greece is always waiting for you...@br…

2018-06-25 09:06

kostas pampalis kostaspampalis

RT @vre_Katerina: Άμα δεν μπορώ να είμαι και κάφρος και κολλητή σου και ερωμένη σου,κάτι λείπει. Θέλω να ξεφτιλιζόμαστε και μετά να γαμιόμα…

2018-06-25 09:05

Helene Vogdou HeleneVogdouDem

Physician Surgeon, Biotechnologist, Cancer Research 🔥🦀

RT @23perry245: @faid0nz Δακρυγόνα και κρότου λάμψης στον κόσμο στο συλλαλητήριο κατά της συμφωνίας των Πρεσπών με τα Σκόπια, στη #Θεσσαλ…

2018-06-25 09:05

Dexios Thessalos DexiosThessalos

ΠΑΚΗ ΠΑΡΑΙΤΗΣΟΥ.

RT @ta_nea: Σε περιδίνηση η κυβέρνηση - Πήραν προληπτική γραμμή χωρίς λεφτά μέσω του χρήστη @ta_nea

2018-06-25 09:05

Jos Verstappen JosVerstappen2

Μου τη δινουν οι φιλοσοφιες του κ@λου.Φαν της θειας Χαρίκλειας του Μεφιστοφελη.Carpenter δεν ξεχνω το search!

RT @diesi_31_diesi: Παιδιά οποιος μπορεί να βοηθήσει θελουμε 3 φιάλες

2018-06-25 09:05

Ανθή anthianthia

Διδάσκω την πιο όμορφη γλώσσα του κόσμου 📚
(ταπεινό ακκάουντ)

RT @matthaiosleonid: Κάποιος που να μην πήγε στην Άννα Βίσση στο Σταύρος Νιαρχος; Όχι ε;

2018-06-25 09:05

iwn_mpalaklavas iwn_mpalaklavas

Προσπαθώ να ισορροπήσω ανάμεσα στην πνευματικότητα και τα γαμωσταυρίδια.

RT @Pa__Nikos: Σε πληρη συνεργασία μπάτσοι και ναζι στην επίθεση στα Πετράλωνα , μετα την επίθεση μπουκαραν στον ηλεκτρικό με την προστασία…

2018-06-25 09:05

Umut Erdogan umutterdogan

Si vis pacem, para bellum! ~ Forza Göztepe!

Cinsiyetçiliğin daniskası. Meral Anne nerede feminist faşist?

2018-06-25 09:05

@plouizos9951 plouizos99511

Η ειλικρίνεια, η αγάπη για το συνάνθρωπο και η εργατικότητα.

RT @NChatzinikolaou: Καληνύχτα!

2018-06-25 09:05

kostas glikas kostasglikas

#GearBest #Shootout #Game WIN Your OnePlus 6 in our #GearBest #MidYearSale #Shootout #Game! Shoot and score tons of…

2018-06-25 09:05

Κύων ο φιλόσοφος perigraptos

Λίγα λόγια και καλά... no words, only chords and whiskey on the rocks. Instagram:

RT @EGrettou: -Μωρό μου είσαι για λίγο φίκι-φίκι.
-Δεν τρώω σούσι.

2018-06-25 09:05

Periklis Pandikaios

Jurist mit Studium in Marburg & Osnabrück. Politisch Interessierter auf der Suche nach der Wahrheit.Pandikaios=Der Allgerechte

RT @papadimoulis: Πρωτοστάτησα στο ομόφωνο ψήφισμα της Ευρωβουλής για την άμεση απελευθέρωση των 2 Ελλήνων στρατιωτικών. Σε αυτά τα θέματα…

2018-06-25 09:05

tsana mariana tmariana

Μεσ' το όπλο σου σφαίρα

Lol

2018-06-25 09:05

pistepseto pistepseto

😋

Το γηραιότερο ζευγάρι στην Αμερική γιορτάζει την 85η επέτειο γάμου του και μοιράζεται μαζί μας το μυστικό της επιτυ…

2018-06-25 09:05

Radio Mikrasiatis Mikrasia_Radio

Ραδιόφωνο για μερακληδες...

#NowPlaying on #Mikrasiatis_Radio
Κώστας Βουτυράς - Μια Σμυρνιά στο παραθύρι

2018-06-25 09:04

Muhire Muhirela

@mergimsApp | Commissioner @RwandaUnity Young Global Leader Award @LeadersME 2017 Free Education 4All | Book #StartingFromTheBush

RT @diioannid: Amazing animation on #SyntheticBiology [#video] | Dmitriy Medvedev, Andrei Myshev, @Vasil_Hnatiuk @SibilevDenis via @purpose…

2018-06-25 09:04

Red Riding Hood TheRedRHood

• Where's your will to be weird? JM •

RT @beatBukowski: για πότε γεννάτε, για πότε αρχίζετε τις φωτος με το παιδί, για πότε τρώτε απόκρυψη, χαμπαρι δεν παιρνετε

2018-06-25 09:04

protothema.gr protothema

Greece’s No. 1 news site & best-selling Sunday newspaper. Follow for breaking news, special reports and more from
@protothema / #protothema

Ετοιμάζει «βόμβα» με αποχώρησή του από την εθνική Αιγύπτου ο Σαλάχ #protothema

2018-06-25 09:04

alicia • persson aliciaaapersson

lite finare lite bättre

RT @pascalidou: Att Durmaz ska behöva stå där och säga självklarheter som att han är svensk och bär flaggan med stolthet. Skulle någon anna…

2018-06-25 09:04

E-prosfores E_prosfores

E-prosfores ★ Προσφορές από μια καρφίτσα έως ένα Ελικόπτερο... ★ info@e-prosfores.eu ★ #Eprosfores #deals #shopping #προσφορές

Κρέμα που Μειώνει αποτελεσματικά την ταχύτητα της ανάπτυξης της τρίχας ✔ #Eprosfores

2018-06-25 09:04

in-between annamar51806510

RT @EGrettou: Μπεδεύτετε μονίμως το "δείχνομαι" με το "ξεχωρίζω" και ξεφτιλίζεστε.Εμένα δεν με νοιάζει για σας το λέω.

2018-06-25 09:04

ORANGE DIOLIGIO

Όλα έπρεπε να γίνουν.
Μόνο η νύχτα
δεν έπρεπε γλυκιά έτσι τώρα να ‘ναι,
να παίζουνε τ’ αστέρια εκεί ψηλά, σαν μάτια...
και σαν να μου γελάνε.

RT @kanaliotis:

2018-06-25 09:04

BinDNA bindna

DNA Sequence Generator

AGATTTGGGGCCGTACCCCCCGGGCGTGAGAACCGAAAGCGGTAATATGATCCCAAGTGCGCTAGGGGAACTTGTGCGTTCCTGGGAGTGCGTTAGTTTTTGGCGGTCTAATGAG…

2018-06-25 09:04

BinDNA bindna

DNA Sequence Generator

GGACCGCATTGCTATATATGACTATGAAACCTGAGTGACTCGCGACTTGGGCCCCACACTACTTCGCGTCTTGGAGTTGACAGAAATTGGGCTGGTTCTTGCGATTAGCATGAAA…

2018-06-25 09:04

BinDNA bindna

DNA Sequence Generator

CCCAAGTGTTCGATGAGACCGCCACTTTTAACAGACTAAACCTCTGTAGAGCTGTCATGCAGACATATGCGCTGTAAGAACTATGGCGTGAGTAAGCTAACTCCCGTAGCAAATA…

2018-06-25 09:04

BinDNA bindna

DNA Sequence Generator

AGATTAAGTTGACTCCCCCCATGTGAGTGTACGCTTCAACGACGACGCCTAGACACCCCAAAGGCATCACTGTTGAAACATAAACCTCACCGAATAAAGTGCACGCTAAGTTCCC…

2018-06-25 09:04

siks siks

RT @ThanasiPap: Πλέον στο ποδόσφαιρο γειτονιάς ο άμπαλος δεν θα παίζει αναγκαστικά τερματοφύλακας. Θα του δίνουν ένα κινητό, θα στέκεται στ…

2018-06-25 09:04

BinDNA bindna

DNA Sequence Generator

CCCCACTGCCTGGCTCTTGTTAATCCGGCTAAGGATTCGGGCGGATAATACCAGTCAGCCAGACATGGGTATCCTAATACGCACGCCCCATGGAATCTCAAAAGCGAAAGGCGAG…

2018-06-25 09:04

BinDNA bindna

DNA Sequence Generator

GTGCTGGAATACCAACGTTGATGCGGAACGTGGCTTGATCTTTCTCGTACCACAATGGTACGGTGAAAAGAACATTCTGACAATTGGCAATAGCGGATCACCTTGTAAGGACTCA…

2018-06-25 09:03

BinDNA bindna

DNA Sequence Generator

ACGTTTCAGTACAGAAAGCTCCGGTGCTTCCATTTCTCGCAGAACCGTACTCGCCACTCTCGGAGCCCAGCCGGGAATTCATGGAATGTTCTCCGTTTTTGGGCCTTAATTCCTT…

2018-06-25 09:03

in-between annamar51806510

RT @EGrettou: -Ρε φίλε έμεινε το αμάξι απο μπαταρία,γύρισα σπίτι και έπιασα τη γυναίκα μου με άλλον.Χρειάζομαι βοήθεια.
-Σόρυ ρε 'συ αλλά δ…

2018-06-25 09:03

@ntistasi.gr active_net

Kανάλι Επικοινωνίας & Δυκτίωσης Κοινωνικών Δράσεων.

Top story: Souidos on Twitter: "Αυθόρμητη #antifa πορεία στα Πετράλωνα τώρα μετ… see more

2018-06-25 09:03

Tελεία και Παύλα vre_Katerina

Μια ρομαντική ρεαλίστρια.

Ζω για να κατακτώ. Ο Μέγας Αλέξανδρος στο θηλυκό

2018-06-25 09:03

in-between annamar51806510

RT @EGrettou: Το να κάνεις τον κιμά γιουβαρλάκια,πρέπει να διώκετε ποινικά.

2018-06-25 09:03

TA NEA ta_nea

Καθημερινή έγκυρη ενημέρωση από «TA NEA»

Βρήκαν νεκρό 29χρονο ιερέα στο σπίτι του στη Λάρισα μέσω του χρήστη @ta_nea

2018-06-25 09:03

in-between annamar51806510

RT @EGrettou: -Μωρό μου είσαι για λίγο φίκι-φίκι.
-Δεν τρώω σούσι.

2018-06-25 09:03

in-between annamar51806510

RT @EGrettou: Έχει βάλει ο άλλος Μπιθικώτση και νιώθω σαν να με λένε κυρα-Ζηνοβία,να ζώ στο Πέραμα και να ξενοπλένω σε σκάφη,σκουπίζοντας τ…

2018-06-25 09:03

Evi evikop

RT @vre_Katerina: Είμαι μέσα στην ευδαιμονία

2018-06-25 09:03

Tελεία και Παύλα vre_Katerina

Μια ρομαντική ρεαλίστρια.

Εντάξει πριν σας κατακτήσω μέχρι και σε ξυλοπόδαρα περπατάω. Τρε ο ενθουσιασμός τρε. Αφού σας κατακτήσω βαριέμαι χαχαχα

2018-06-25 09:03

Νταουλιέρης kandrianopoulos

Πρώτη Φορά Αριστερά!

RT @papoulakoskon: Ο Βουλευτής του ΣΥΡΙΖΑ Πετρος Κωνσταντινέας @pkonstantineas7 με έκανε μπλοκ επειδή του εγραψα ότι δεν μπορεί να μιλάει α…

2018-06-25 09:03

buba❤buba JoeBaggelis

back to life.. back to reality.. 🌷🖤🌷

RT @toumvas: Παντού βροχές κ βλέπω να περνάει πυροσβεστικό αεροπλάνο, λογικά πάει να ρίξει νερό κάπου που δεν έβρεξε ακόμα.

2018-06-25 09:03

Kholoud💫 khldtrk

living in a bubble about to burst ••••••••••••••••••••••••••••••••• MY HEART NAMED @turkishxaru

RT @asteraki90: Meaningful hsgdjkdbs #BoranKuzum

2018-06-25 09:03

☽ Hayato OSTINATO vendangeuse

mauditだよ。サイケデリック・バンドOSTINATOの詩と歌とギター担当、河合楽器のムーンサルト使い。脳出血による左腕麻痺のため右手だけでギター弾きます。

RT @ekkremothtes: λογαριάζοντας αβέβαιες ελπίδες
ξαγρυπνήσαμε στ' όνειρο ατέλειωτες νύχτες
καλή σας νύχτα

2018-06-25 09:03

Media Ad Group | MAG mediaadgroup

Media Ad Group | #MAG Marketing Network is based in LA. Brands include @socialmaxorg @cajuntvnetwork @cookingwithkade @magmediafactory @3rdrockcrypto @ktechxyz

RT @diioannid: Time for a real flight on a floating car. See people's reaction [#video] | via ShareChat

@evankirstel @jblefevre60 @MikeQui…

2018-06-25 09:03

kostas pampalis kostaspampalis

RT @altanitsa: Καλημέρα και καλή Κυριακή να έχουμε με ότι πιο πολύ μπορούμε!!
Είτε να νιώσουμε είτε να δώσουμε!! Εκείνοι που είναι λίγοι κα…

2018-06-25 09:03

xruxru mooodswings

Lead designer @pollfish, but mainly posting stuff I design while in playground mode. Views are your own.

Zooo brand identity /via #dribbble #Logo #LogoDesign #graphicdesign #branding #brand…

2018-06-25 09:02

xenia arkoudosxxl

RT @zoosos: Δίνουν αμοιβή σε όποιον καταθέσει ποιος δηλητηρίασε με #φόλα #σκύλο στην Αγία Βαρβάρα Αττικής …

2018-06-25 09:02

Full Of Helium full_of_helium

I’m a ballon, up to the sky, looking for a better place into the clouds.

@Bulbasaur000 Την είδαμε την διαφορά εδώ και καιρό. Συγκεκριμένα απο τις αλλαγες. Όλοι είδαμε. Α σορρυ όχι όλοι.

2018-06-25 09:02

kate equally_dour

🌟 you seem starshaped 🌟

What did I wake up to? 😭💙😭💙😭

2018-06-25 09:02

Effrosyni Moschoudi FrostieMoss

Greek writer, book/travel blogger, film buff, Corfu lover, perveyor of #Greek #recipes. Visit my site for FREE books, guide to #Moraitika #Messonghi #Corfu

Five Temples of Mythic #Greece #gods #goddesses #myths

2018-06-25 09:02

Gyristroula gyristroula82

Αν δείτε το παλιό μου ακκάου πείτε του πως το ψάχνω...
Εξαντλήθηκα κ επανακυκλοφορώ. .

RT @vre_Katerina: Άμα δεν μπορώ να είμαι και κάφρος και κολλητή σου και ερωμένη σου,κάτι λείπει. Θέλω να ξεφτιλιζόμαστε και μετά να γαμιόμα…

2018-06-25 09:02

alice foulcher alicefoulcher

writer-actor-person 🎥 @ThatsNotMeFilm w/ 🦁 @gregoryerdstein 🍿 Just yelling into the void, like everyone else 😀

RT @bjennymontero:

2018-06-25 09:02

naturalaffection natureaffect

Natural Homemade Skincare Products

#Natural #DIY #homemade #skincare #organic #vegan #marketing #startup #seo 00:02:02

2018-06-25 09:02

Durutti Degian durutti13

Γενικη πολιτικη followback εκτος αν εισαι και γαμω τα παιδια και σε ακολουθω ετσι κ αλλιως.. Σχολια για πουτσα(πολιτικη),μπαλα(ΠΑΝΑΘΑ) κ τραμπαλα (επικαιροτητα)

Χοντραίνει το παιχνίδι

2018-06-25 09:01

Tελεία και Παύλα vre_Katerina

Μια ρομαντική ρεαλίστρια.

Άμα δεν μπορώ να είμαι και κάφρος και κολλητή σου και ερωμένη σου,κάτι λείπει. Θέλω να ξεφτιλιζόμαστε και μετά να γαμιόμαστε

2018-06-25 09:01

Social Sherpa _socialsherpa

Social Media News & Tips for businesses! Learn to Leverage #socialmedia for success in #business & #career. Sales-oriented Social Media Marketer #smm #ppc #cpc

RT @diioannid: The #SearchEngineOptimization Tasks [#infographic] | via @Bill_IoT

#marketing #onlinemarketing #digitalmarketing #seo #con…

2018-06-25 09:01

buba❤buba JoeBaggelis

back to life.. back to reality.. 🌷🖤🌷

RT @vre_Katerina: Μου λέει δε νυστάζεις.Όχι του λέω είμαι παιδί της νύχτας.Κάνω καριέρα με το Μαζωνάκη. Καλά παιδί της νύχτας μου λέει εγώ…

2018-06-25 09:01

The IT guy... steliosbakeas

IT support is my job, computer science my education, bouzouki, dancing and pagkaki.gr my hobbies.

It's #MyTwitterAnniversary! I have been on Twitter for 8 years (since 25 Jun 2010).
And you?

2018-06-25 09:01

João 🇵🇹 joaocaseiro1999

Benfica, Barça e Académica

RT @manolis1983: Portugal 🇵🇹 day
#POR

2018-06-25 09:01

Mobzi MobziPUBG

Competitive PUBG Player for @Ho_Nobles | @Twitch partner | email: mobzigreen@gmail.com

@Interrogreat

2018-06-25 09:01

Jim Gerakaris jimgerakaris

RT @dromografos: Οι Φασίστες κάνουν επίθεση σε κατάληψη ανενόχλητοι, τραυματίζουν άτομο, η αστυνομία προσαγάγει αντιφασίστες γιατί αντιστά…

2018-06-25 09:01

GreeceGram Greecegram_com

GreeceGram is a travel blog that is a lot more than just a travel blog.
#travel #greece #mountainscape #seascape #hiking #alternative #indie #blogger #expert

The #mysterious #cave of #maronia #magic #history #greece #travel #thrace

2018-06-25 09:01

The Sunni liberal mohamedmha

يسقط الاخوان والقوميون واليسار والمقاومه والحشدالشيعي 🇪🇬🇸🇦🇫🇷🇺🇸عاش الحلف السعودي الامريكي الفرنسي تحيا مصر

RT @sofiazacharaki: Να επισημάνουμε ότι και στις τουρκικές εκλογές επιτρέπεται να ψηφίζουν οι Τούρκοι του εξωτερικού. Δόθηκε η ευκαιρία σε…

2018-06-25 09:01

wuqilin wuqilin4

天下之大无奇不有⋯

RT @LSpyropoulou: Take a glimpse of Sting singing under #Acropolis #Greece @periscopeco @periscopetv

2018-06-25 09:00

Tελεία και Παύλα vre_Katerina

Μια ρομαντική ρεαλίστρια.

Εκεί που αράζω με τον εκάστοτε τύπο του λέω κοίτα τι περνάει φίλε κοίτα. Εγώ το βλέπω δίπλα μου μού λέει που αράζει…

2018-06-25 09:00

kostas pampalis kostaspampalis

RT @paspar_tou: Η γενναιοδωρία καμμιά φορά εκτός από καλό άνθρωπο μπορεί να σε χαρακτηρίσει και μαλάκα ας τα θεωρήσω και τα δύο τιμή

2018-06-25 09:00

Nati 🇵🇹 NaterciaMoreira

E Pluribus Unum

RT @manolis1983: Portugal 🇵🇹 day
#POR

2018-06-25 09:00

Greece Outside In GreeceOutsideIn

We collect news about Greece from all over the world

Greek gay pride marchers abused and thrown into sea #Greece #news

2018-06-25 09:00

Savvas Grace Desosav

IT Professional, Video Gamer, Metalhead, Photo Enthusiast

I won the Enchanted Weapon achievement in Dark Souls: Remastered for 34 #TrueAchievement points

2018-06-25 09:00