Tweets at Acharnes around 30km

It searches the Tweets of Twitter around Acharnes 30km.


Search Results

Lamprini karagianni Lamkarr

Αγαπώ τους ευφυείς και είμαι αυστηρή με όσους αγαπώ.

RT @papachristosgio: Κατά τα υπόγεια του Μαξίμου η -μείον 13 μονάδες -δημοσκόπηση των ΝΕΩΝ ειναι μια εξυπηρέτηση του υπόδικου Μαρινακη στον…

2018-04-22 14:03

Tasos K TASOS__K

Quote of the Day: "Worry never robs tomorrow of its sorrow, it only saps today of its joy." - Leo Buscaglia

2018-04-22 14:03

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:02

nik fars NFars

Δεν αρέσω σε όλους αλλά δεν με ενδιαφέρουν όλοι .. !!

RT @argie810: ..οταν αποφασίζεις να δώσεις τέλος σε μια σχέση κρατάς τις καλές αναμνήσεις στη καρδιά σου και τις άσχημες στο μυαλό σου...γι…

2018-04-22 14:02

nikos tar nikos9551

RT @toumvas: -Πετ σοπ εκεί;
-Μάλιστα τι θα θέλατε;
-Κάτι να παίζω με το πουλί μου.
-Έχετε δει κάτι στο μαγαζί μας;
-Την υπάλληλο.

2018-04-22 14:02

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:02

George ✈ geokonst

το κορμί σου το φιδίσιο που είναι μπρος και πίσω ίσιο

RT @toumvas: -Πετ σοπ εκεί;
-Μάλιστα τι θα θέλατε;
-Κάτι να παίζω με το πουλί μου.
-Έχετε δει κάτι στο μαγαζί μας;
-Την υπάλληλο.

2018-04-22 14:02

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:02

jasmin Reyes⚓ jasminfloresre1

Someday,evrything will make perfect sense.So for now,laugh at the confusion,smile thru the tears and keep remnding yourself that evrything happens for a reasons

RT @05Roche: Pls visit all the links below as a support Sa first TVC ni @vivoree.More views,more blessings.Thanx

Naka pinned tweet ito Sa…

2018-04-22 14:02

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:02

Sperma schlucken Sahnemaul

Ich mag lange lutschen und viel schlucken. Ich genieße die geschüttelte Sahne in meinem Sahnemaul. 😀

Hi, ich bin die Lola :) Nun schon seit 3 jahren aktiv im Amateurbereich unterwegs. Anfangs habe ich mir meine Physi…

2018-04-22 14:02

Lil China 🐍⛩🇧🇩 Flashyasf

Real One #myasu

RT @PerfectRauhll_: hmmm.

2018-04-22 14:02

ΑΝΔΡΕΑΣ andreas22hellas

ΠΟΛΛΑ ΤΑ ΚΑΚΑ ΜΑ ΚΑΝΕΝΑ ΧΕΙΡΟΤΕΡΟ ΑΠ ΤΟΝ ΑΝΘΡΩΠΟ...

RT @JoannaStauropo1: Καλήμέρες πολλές παντου.

2018-04-22 14:02

Ηλίας του 16ου Hlias_Grigor

today's stats : 8 non-followers. found via

2018-04-22 14:02

ΑΠΕ-ΜΠΕ amna_news

Αθηναϊκό - Μακεδονικό Πρακτορείο Ειδήσεων: το εθνικό ειδησεογραφικό πρακτορείο της Ελλάδας |English: @amna_newseng |Sport: @praktoreiosport

Παρουσία του Χρ.#Σπίρτζη φτάνει σήμερα στον σταθμό "Νομαρχία" ο μετροπόντικας "Φρίξος"

2018-04-22 14:02

VICO Movement VICOmovement

Handmade Footwear & Accessories / Crafted in Europe / Move Forward and resist the usual / Shipping Worldwide ✈️ SALE is Live #vicomovement

Anafiotika is a hidden wonder inside the bustling metropolis. This area is the result of skilled…

2018-04-22 14:02

nik fars NFars

Δεν αρέσω σε όλους αλλά δεν με ενδιαφέρουν όλοι .. !!

RT @Alexandros_V84: Ώρες ώρες περιμένω το σαββατοκύριακο όπως η ορμή που χτυπάει το κύμα σε ενα βράχο...

Καλημέρα!!

2018-04-22 14:02

roz orchidea roz_orchidea

RT @Dasydo: ❤️ΕΧΟΥΜΕ ΠΟΛΛΑ ΠΤΥΧΙΑ, ΛΙΓΟΥΣ ΣKΕΠΤΟΜΕΝΟΥΣ. ΠΟΛΛΗ ΓΝΩΣΗ, ΛΙΓΟΤΕΡΗ ΚΡΙΣΗ. ΜΙΛΑΜΕ ΠΟΛΥ, ΑΚΟΥΜΕ ΛΙΓΟ, ΑΓΑΠΑΜΕ ΣΠΑΝΙΑ, ΜΙΣΟΥΜΕ ΣΥΧ…

2018-04-22 14:02

Takis Hatzis takishatzis

Σήμερα στις 10:00 στον ΣΚΑΙ @skaigr στο #akraiws ΑΚΡΑΙΩΣ @takishatzis καλεσμένοι ο Νίκος Ξυδάκης @nikoxy οΝικος Δέν…

2018-04-22 14:02

BinDNA bindna

DNA Sequence Generator

GATCCCAATATTCCTCATACGCGATGGGGTGGGTGAATTGCTTAGATGATACGTGATAGCTCATATAGGACGAGATCATTGTTTAGTTGCCAGACGGTGGGCTGGCTAACACCGG…

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

AATCATTTGTACGATGTGCCATAGCAAAATCAAACCAGTTTAAGGCGGAAGTCGTCTCCCCTGCGACAGGTGCGATCCACGGGCCCCTTGGTAAGCGCTGCCAATCACTCACCCC…

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

TGTATGAGGTCTGGCGCAATTTGATGTTAAGGTCATGTCACCCGCCGTTTGGCACAAGAACTCGCGACTTGTAGTACGTTCGTGTACCTTGTCCCAGCGTTTAGGCATTCAATCC…

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

TGTCGGACGGGATATGCAATGACCACTGCTGGCATCAGGGCCAGAGCACACGCCTGTAGGAGGATGGCGGCGCGTTACTCCCTTCGTCTGTCCGTGACAAATCTTTAAGACTAGA…

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

AGTAGATTCCTAACGACGCAGTGAACGCTCTTAAGGAAGGGCGAATAGTAGCGATTTCTGGCTGTCAATATAACCTGCAATGTAAAAGTTCTCCTAGCTTCGACGGTCCGCCTTG…

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

TATTTGTGACCACTGACAAGTATATAGGAGTGGCAAGGTAATGCCTTGTTTTGTGAATGAACTGTCGCCTCCCACGTTGCTGTCGGCCTATTCTAGCCCTACAGGGAGGCCTCCG…

2018-04-22 14:01

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @JoannaStauropo1: Η πραγματική ομορφιά ενός ανθρώπου, κρέμεται στην άκρη της γλώσσας.

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

CCCGCAATTTCTATCGTGTACGGCTTGCCGCGACCAGTTCTTTGTGCACGGTGCGAAACGGCTTGAGCCGTCCTATCGCACTGAGGACGAAGCCGAAACGCCTCGTTGGGTCCGT…

2018-04-22 14:01

BinDNA bindna

DNA Sequence Generator

TTCGCGCTTGCGTCGGGCTCCGAGCGTGCGGGGGTGTTGCGCGATATCTGCCCTTTATACGTGTGGCTGGCTTTGCAGACCTGAGATCTCACTATGGAGCCCATCAGTGGTGTTC…

2018-04-22 14:01

emiVivoree leademily

V-lieve

RT @05Roche: Pls visit all the links below as a support Sa first TVC ni @vivoree.More views,more blessings.Thanx

Naka pinned tweet ito Sa…

2018-04-22 14:01

ioannis nitrodizon

ακαουντ που γραφει ή σχολιαζει επι παντος του επιστητου.ειμαστε ολογραμματα μεσα σ ενα ολογραμμα. followback 100%

RT @PapanGeorge: Μια ξενοκινητη οικονομική χούντα ζούμε και σήμερα. Απλά τα τανκς γίνανε κεντρικές και τοπικές τράπεζες, και οι στρατιωτικέ…

2018-04-22 14:01

renato michelini renato1262

RT @JoannaStauropo1: Καλήμέρες πολλές παντου.

2018-04-22 14:01

VIVOREE☔🌈⛅ hayyyyyssst

RT @05Roche: Pls visit all the links below as a support Sa first TVC ni @vivoree.More views,more blessings.Thanx

Naka pinned tweet ito Sa…

2018-04-22 14:01

o kiklos kikloi

hey new fascists leave our kids alone!

Retweeted Parapolitika Kritis (@parapolitika1):

Αλλάζει ρότα ο Ερντογάν «Η ειρήνη με την Ελλάδα αξίζει όσο καμία ά…

2018-04-22 14:01

J. julieee723

i am made up entirely of flaws, but stitched together perfectly by grace

RT @ugabarstool: *clears throat*

IT'S SATURDAY IN ATHENS

2018-04-22 14:01

Ελενη 9ua1kXgxzL6NR5W

RT @altanitsa: Η αλήθεια είναι ότι αυτό που λέγεται ευτυχία δεν την έχεις στο τσεπακι σου ούτε και σε περιμένει στην επόμενη γωνία. Παίρνει…

2018-04-22 14:01

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:01

Novartios KakosLykos2

Οι κραυγές

RT @EiriniLampraki: Για να επιστρέψουν θα κάνουν τα πάντα. Ακόμα και σε ένα θερμό επεισόδιο, θα υποστηρίξουν τον Ερντογάν έναντι της εκλεγμ…

2018-04-22 14:01

GreekAncientCosmos 123tgou

Fine Sculptures by Bronze and Terracotta.
Hand Made Artworks influenced by Ancient Greece.
'' O μεν βίος βραχύς , η δε τέχνη μακρά ''

Discovolous.....

2018-04-22 14:01

GreekAncientCosmos 123tgou

Fine Sculptures by Bronze and Terracotta.
Hand Made Artworks influenced by Ancient Greece.
'' O μεν βίος βραχύς , η δε τέχνη μακρά ''

Horseman from Dodonis ...

2018-04-22 14:01

O-Sr. doubleOGbckwrdz

oog_backwrdz ~ instagram & snapchat #RIPJared #RIPLilAnt #FreeBobLo #teamWade #Eagles #Flyers #UGA #Braves

RT @ugabarstool: Justin Fields with the dime 👀

2018-04-22 14:01

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:01

COBRA argyris446

ΑΣΕ ΜΗ ΤΟ ΨΑΧΝΕΙΣ

ΑΚΑΝΘΟΧΟΙΡΟΣ: Η ΜΟΙΡΑΙΑ ΓΥΝΑΙΚΑ ΜΕ ΤΑ ΜΑΚΡΥΑ ΜΑΛΛΙΑ

2018-04-22 14:01

angel mil50147797

RT @05Roche: Pls visit all the links below as a support Sa first TVC ni @vivoree.More views,more blessings.Thanx

Naka pinned tweet ito Sa…

2018-04-22 14:01

Astrology.gr astrologygr

**Η Αστρολογική σου Συνήθεια!**

Η φράση - κλειδί του ζωδίου σου για σήμερα, 22/04

2018-04-22 14:01

Takis Hatzis takishatzis

«Βόμβα» Ερντογάν: Ζήτησε ανταλλαγή των δύο Ελλήνων στρατιωτικών με τους «8»!

2018-04-22 14:01

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:00

Norika🍎 norathomaidou

Τρελαίνομαι για μηλόπιτα

RT @mikromary: Αν δεν μας κανετε να ξεκαρδιζομαστε απ τα γελια κ να πεφτουμε απο καρεκλες, κρεβατια, καναπεδες, δεν σας θελουμε ρε

2018-04-22 14:00

Politwoops Greece politwoopsgr

An archive of public tweets, deleted by politicians in Greece.

DT Giannis Vroutsis: RT Giannis Vroutsis: Που να ερθουν κ τα νεα μέτρα....
1-3 συνταξεις για ολο...

2018-04-22 14:00

ΑΠΕ-ΜΠΕ amna_news

Αθηναϊκό - Μακεδονικό Πρακτορείο Ειδήσεων: το εθνικό ειδησεογραφικό πρακτορείο της Ελλάδας |English: @amna_newseng |Sport: @praktoreiosport

.@rterdogan_ar : «δεν επιθυμούμε να ανέβει το θερμόμετρο στο Αιγαίο»

2018-04-22 14:00

soʞnoʞ@ koukos

ส้้้้้้้้้้้้้้้้้้้้้้้้้้้้้ viewer discretion advised ส้้้้้้้้้้้้้้้้้้้้้้้้้้้้้

Καλήμερα :) Carpe DM

2018-04-22 14:00

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:00

hopeless romantic berryboharry

💞𝓰𝓪𝓻ç𝓸𝓷 𝓪𝓶𝓸𝓾𝓻𝓮𝓾𝔁 💞

@lilbootycall I’m down

2018-04-22 14:00

Norika🍎 norathomaidou

Τρελαίνομαι για μηλόπιτα

RT @mikromary: Πλεον δεν χτιζω, ουτε γκρεμιζω. Μόνο ζω τη στιγμη

2018-04-22 14:00

look mom..........no hands maryskyis

Εγώ ήθελα! Εσύ δεν μπορούσες να με διαχειριστείς Και τελικά βρήκα κάποιον να μου ανάβει τα λαμπάκια που είναι και γαμώ τα άτομα 😘

RT @indianos11: Τα μεθυσμένα μου dm δεν ξεκίνησαν καθόλου καλά. Ας σταματήσω καλύτερα. 😁

2018-04-22 14:00

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:00

travelstyle.gr travelstyle_gr

Το απόλυτο ταξιδιωτικό portal της Ελλάδας! Προορισμοί, ταξιδιωτικά ρεπορτάζ, videos, φωτογραφίες, σούπερ προσφορές και μηχανή online booking, ΟΛΑ ΣΕ ΕΝΑ!

Για να μπαίνουμε σιγά σιγά στο κλίμα...!

2018-04-22 14:00

Άδωνις Γεωργιάδης AdonisGeorgiadi

ΑΝΤΙΠΡΟΕΔΡΟΣ της ΝΕΑΣ ΔΗΜΟΚΡΑΤΙΑΣ FB: Youtube:

RT @capitalgr: Αξιωματούχοι ΥΠΟΙΚ: Μάχη μέχρι τον Ιούνιο για το αφορολόγητο-Αβέβαιη η συμμετοχή του ΔΝΤ

2018-04-22 14:00

wannabe_me Nicole_30sta100

Κυκλοθυμικός χαρακτήρας,τρελή του χωριού.Αγαπώ τη βροχή αλλά όχι τα μπουμπουνητά.Ξοδεύω πολύ χαρτί κουζίνας.
/>

RT @ntokkel: Βλέπαμε τηλεόραση, της λέω "Ωραία τραγουδάει αυτή", "Α, ναι;" λέει και άλλαξε κανάλι.

2018-04-22 14:00

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 14:00

empisteutiko.gr empisteutiko

Το πρώτο website στο Νομό Σερρων Ακολούθησε το!

Σαν Σήμερα Κυριακή 22/04

2018-04-22 14:00

Dave Compton dav3c

Dad. Husband. Runner. Friendly geek. IPTC NewsML-G2 tech lead. Own opinions etc. 2016/Running: 5k to Marathon, offroad HMs, 2500km? +MTB

Stadium #walk @ Panathenaic Stadium

2018-04-22 14:00

GEL.IT.UP Greece gelitupgreece

GEL.IT.UP Greece UV / LED Soak Off Gel Polish

by GIUP®
Chameleon Colors

2018-04-22 14:00

Τσουλουφακι roulapap13

RT @JoannaStauropo1: Καλήμέρες πολλές παντου.

2018-04-22 14:00

Norika🍎 norathomaidou

Τρελαίνομαι για μηλόπιτα

RT @mikromary: Πηγε στη Σαλονικη. Τον λεω "παρε μπουγατσα κ στειλε φωτο να τη δω". Με λεει "δεν με αρεσει η μπουγατσα".
Χωρισμός !

2018-04-22 14:00

OODEgr oodegr

unofficial

By Skye Jethani

2018-04-22 14:00

newpost.gr newpostgr

Μια ομάδα δημοσιογράφων που ενώνουμε τις δυνάμεις μας και ενημερώνουμε με τις ειδήσεις που αξίζει να γνωρίζει κανείς!

Πρόκειται για τους Τάσο Σταματάκη και Δημοσθένη Σεραφειμιδη

2018-04-22 14:00

SMAG SmagGreece

Sexy Celebrity News Gossip Photos

Πεντάστερη, κουπάτη και νταμπλούχα η Μπάρτσα!

2018-04-22 14:00

HuffPost Greece HuffPostGreece

Η επίσημη Ελληνική έκδοση της HuffPost. Blogs, Πολιτική, Κοινωνία, Διεθνές, Τεχνολογία, Viral.

Σε τούτον το φονιά δε ταίριαζε η αρμύρα. Γράφει ο Μανώλης Δημελλάς

2018-04-22 14:00

Brett Hnasko bert_hnasko

RT @ugabarstool: *clears throat*

IT'S SATURDAY IN ATHENS

2018-04-22 14:00

ΝΕΝΑ ΧΡΟΝΟΠΟΥΛΟΥ nenaxronopoulou

ΗΘΟΠΟΙΟΣ-ΣΥΓΓΡΑΦΕΑΣ-ΣΤΙΧΟΥΡΓΟΣ

Φτιάξτε μόνες σας μαλακτικό ρούχων, οικονομικό και φυσικό !

2018-04-22 14:00

ΝΕΝΑ ΧΡΟΝΟΠΟΥΛΟΥ nenaxronopoulou

ΗΘΟΠΟΙΟΣ-ΣΥΓΓΡΑΦΕΑΣ-ΣΤΙΧΟΥΡΓΟΣ

Καλημέρα, μεζές όχι αστεία !!!
Ουρά μοσχαριού στιφάδο με δαμάσκηνα !

2018-04-22 14:00

Riverbend Club Apts RiverbendAthens

Interested in a new Apt? Stop by for a tour to check out our six spacious floorplans as well as our resort style amenities. Office hours: Mon-Fri 9-5 #UGA

#LifeOnTheBend There's no place like home after a busy day of classes at The University of Georgia.

2018-04-22 14:00

ΝΕΝΑ ΧΡΟΝΟΠΟΥΛΟΥ nenaxronopoulou

ΗΘΟΠΟΙΟΣ-ΣΥΓΓΡΑΦΕΑΣ-ΣΤΙΧΟΥΡΓΟΣ

8 οπαδοί που θα συναντούσες ΜΟΝΟ στην Ελλάδα...

2018-04-22 14:00

gazzetta.gr gazzetta_gr

Η καλύτερη δημοσιογραφική ομάδα του αθλητικού internet παίζει μπάλα εδώ!

Το Κύπελλο πολύ σημαντικό για τον ΠΑΟΚ, αφού ο στόχος του πρωταθλήματος δεν επιτεύχθηκε.

2018-04-22 14:00

HolidayGreece HolidayGreece

/> Travelling Tips and Holiday Suggestions about Greek Islands, Boutique, Design, Luxury Hotels and trips to Greece.

Create your once upon a time #memories at one of the remarkable Atrium hotels in #Rhodes.

2018-04-22 14:00

Athens Magazine AthensMagazine

Το Athens Magazine, το επίσημο lifestyle περιοδικό της πόλης, κυκλοφορεί στα καλύτερα!

Θα το δείτε;

2018-04-22 14:00

Toftiaxa.gr | DIY To_ftiaxa_gr

Εδώ τα φτιάχνουμε όλα μόνοι μας! Κατασκευές απο άχρηστα υλικά! Κατασκευές φτιάξτο μόνος σου για το σπίτι, το κήπο, ομορφιά, παιδικές κατασκευές, γιορτίνες, DIY!

Νόστιμο Κυριακάτικο πρωινό για όλη την οικογένεια!

2018-04-22 14:00

ΚΥΡΙΑΚΑΤΙΚΟ ΣΧΟΛΕΙΟ Ksmetanastwn

Το Κ Σ M είναι μια πρωτοβουλία μεταναστών/-τριών και Ελλήνων εθελοντών/-ριών για δωρεάν εκμάθηση της ελληνικής γλώσσας σε εργαζομενους μετανάστες και προσφυγες

Ήταν 22 Απριλίου του 1986, λίγες ημέρες πριν τις φοιτητικές εκλογές εκείνης της χρονιάς. Στο κτήριο της Νομικής επι…

2018-04-22 14:00

Athinais Hotel athinaishotel

Athinais Hotel, δίπλα στο Μέγαρο Μουσικής με 84 ανακαινισμένα δωμάτια, Brrasserie και αίθουσα σεμιναρίων και εκδηλώσεων

Να έχουμε μια πολύ όμορφη Κυριακή :)
Have a lovely Sunday :)

Some of the beutifull Athenian walks are in Mets

2018-04-22 14:00

sokolatomania.gr veniall

Frozen yogurt με σοκολάτα με 3 ΥΛΙΚΑ, από τον Δημήτρη Σκαρμούτσο και το <3…

2018-04-22 14:00

Dimitris Ioannides diioannid

#NewBusinessDevelopment & #Partnerships | #DigitalTransformation Dept.| @Cosmote | Deutsche @Telekom_Group
#Startups #Innovation #GrowthHacking #SocialMedia #AI

How are companies capitalising on #bigdata opportunities? | RT @Orcanintell

#DigitalTransformation #customer…

2018-04-22 14:00

💛JV🐝SocoMode👀👍 Azil1605

Promote Positivity

RT @05Roche: Pls visit all the links below as a support Sa first TVC ni @vivoree.More views,more blessings.Thanx

Naka pinned tweet ito Sa…

2018-04-22 13:59

Τσουλουφακι roulapap13

RT @NomizwZw: Τι εννοείς όταν λες ότι δεν κάνω σωστή διατροφή για βράδυ;
Αφού πρώτα έφαγα τα μακαρόνια με το κιμά και μετά το γιαούρτι.

2018-04-22 13:59

Μάνος manos_ati8asos

Έσβησα το μπιο,γιατί κάποιοι τρόμαζαν

RT @vre_Katerina: Χειρίζομαι καλά και τη γλώσσα. Ομιλώ εννοώ.

2018-04-22 13:59

look mom..........no hands maryskyis

Εγώ ήθελα! Εσύ δεν μπορούσες να με διαχειριστείς Και τελικά βρήκα κάποιον να μου ανάβει τα λαμπάκια που είναι και γαμώ τα άτομα 😘

RT @astrogirl34: Να μαζευτούμε όλοι μαζί με εσάς που βγάζετε συμπεράσματα χωρίς να μας ξέρετε, να μας τα λέτε, να γελάμε

2018-04-22 13:59

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

2018-04-22 13:59

Jim Mongoose JimMongoose

all my faults are normal. NODM από (Λαμία ή 1.70) κ κάτω. Δασκάλα μου η @LiqRom Εκδρομές:

RT @indianos11: Τα μεθυσμένα μου dm δεν ξεκίνησαν καθόλου καλά. Ας σταματήσω καλύτερα. 😁

2018-04-22 13:59

look mom..........no hands maryskyis

Εγώ ήθελα! Εσύ δεν μπορούσες να με διαχειριστείς Και τελικά βρήκα κάποιον να μου ανάβει τα λαμπάκια που είναι και γαμώ τα άτομα 😘

RT @JamesASB: Τι εννοείς κυρά Τετα μου βγήκες ν' απλώσεις στις 1.30 το βράδυ; Είσαι σίγουρη πως περίμενες το πλυντήριο να τελειώσει ή άλλος;

2018-04-22 13:59

o kiklos kikloi

hey new fascists leave our kids alone!

Παιχνίδια Κυριακής για την Α΄Κατηγορία Ρεθύμνου

2018-04-22 13:59

roz orchidea roz_orchidea

RT @altanitsa: Κάτι τέτοια πρωινά φαντάζομαι και λέω αξίζει να περιμένεις να το ζήσεις ξανά.

2018-04-22 13:58

Nymphomaniac sexymuffyp

RT @Dark_Side_Gr: Deluxe #RimJob 4!
Nia's Black First Date with @KristofCale
Man Ass Eating @GirlsRimming style!😀
Nia gave Kristof's Man H…

2018-04-22 13:58

Spiros Karaviotis sgkher

RT @TerensQuick: Καλημέρα Μιχάλη. Καλημέρα πατρίδα. Σήμερα θα τιμήσουμε τους Αρμένιους αδελφούς μας συμμετέχοντας στις εκδηλώσεις που διοργ…

2018-04-22 13:58

Δημητρούλης Γεώργιος ashbringer0891

Computer programmer.

Καλημέρες.

2018-04-22 13:58

Jim Mongoose JimMongoose

all my faults are normal. NODM από (Λαμία ή 1.70) κ κάτω. Δασκάλα μου η @LiqRom Εκδρομές:

RT @JamesASB: Αυτή τη γάτα την είχα μαθήτρια

2018-04-22 13:58

LoVe q C VIvOrEe EsCliTO ricel_perolina

mahal q c vivoree

RT @05Roche: Pls visit all the links below as a support Sa first TVC ni @vivoree.More views,more blessings.Thanx

Naka pinned tweet ito Sa…

2018-04-22 13:58

Alexandros Ligidakis Alex_Ligidakis

ΔΕΝ ειμαι ΜΟΝΟΣ ( για τους /τις περιεργους /ργες )

RT @g_akis: Με αφορμή τη σημερινή ημέρα θυμίζω ότι το 2015 ο Λαφαζάνης είχε προτείνει στον Τσίπρα να γίνει έφοδος στην Τράπεζα της Ελλάδος-…

2018-04-22 13:58

Ινδιάνος indianos11

in the time of chimpanzees i was a monkey

Τα μεθυσμένα μου dm δεν ξεκίνησαν καθόλου καλά. Ας σταματήσω καλύτερα. 😁

2018-04-22 13:57

Susanne Leist SusanneLeist

MBA in Finance. Author of The Dead Game, a paranormal suspense where a small town becomes a dark haven for evi.

RT @Mystery_Romance: 🎉🎉🎉 #NewRelease 🎉🎉🎉
Grab this captivating Romantic Suspense Collection for only $1.99
at #Kindle

2018-04-22 13:57

Ηθικός Πλεονέκτης Afragos7

Στα παπαρια μου ο Τσιπρας ουτε που τον ψηφισα αλλα τέτοιο μίσος, εμπάθεια και οργανωμένη λάσπη δεν εχει φάει καμία άλλη κυβέρνηση ποτε

RT @AthanDim: Ήθελα να 'ξερα τι διαμαρτύρεται η #UNICEF για λίγα φαγωμένα ψωροεκατομμύρια...
Μαζί της θα τα πάρει; Ρε, τα σάβανα δεν έχουν…

2018-04-22 13:57

Tania Ι.🌹 altanitsa

Και αν η ζωή σε φτάνει στα όρια το κάνει κυρίως για ένα λόγο.Να τα ξεπεράσεις!

RT @JoannaStauropo1: Καλήμέρες πολλές παντου.

2018-04-22 13:57